-
Epidemiologic association and shared genetic architecture between cataract and hearing difficulties among middle-aged and older adults Hum. Genomics (IF 4.5) Pub Date : 2024-04-17 Xiayin Zhang, Shan Wang, Shunming Liu, Zijing Du, Guanrong Wu, Yingying Liang, Yu Huang, Xianwen Shang, Yijun Hu, Zhuoting Zhu, Wei Sun, Xueli Zhang, Honghua Yu
Age-related cataract and hearing difficulties are major sensory disorders that often co-exist in the global-wide elderly and have a tangible influence on the quality of life. However, the epidemiologic association between cataract and hearing difficulties remains unexplored, while little is known about whether the two share their genetic etiology. We first investigated the clinical association between
-
Altered skin microbiome, inflammation, and JAK/STAT signaling in Southeast Asian ichthyosis patients Hum. Genomics (IF 4.5) Pub Date : 2024-04-16 Minh Ho, Huynh-Nga Nguyen, Minh Van Hoang, Tien Thuy Thi Bui, Bao-Quoc Vu, Truc Huong Thi Dinh, Hoa Thi My Vo, Diana C. Blaydon, Sherif A. Eldirany, Christopher G. Bunick, Chi-Bao Bui
Congenital ichthyosis (CI) is a collective group of rare hereditary skin disorders. Patients present with epidermal scaling, fissuring, chronic inflammation, and increased susceptibility to infections. Recently, there is increased interest in the skin microbiome; therefore, we hypothesized that CI patients likely exhibit an abnormal profile of epidermal microbes because of their various underlying
-
The causal associations of circulating lipids with Barrett’s Esophagus and Esophageal Cancer: a bi-directional, two sample mendelian randomization analysis Hum. Genomics (IF 4.5) Pub Date : 2024-04-16 Baofeng Li, Meng Li, Xiao Qi, Ti Tong, Guangxin zhang
The causal associations of circulating lipids with Barrett’s Esophagus (BE) and Esophageal Cancer (EC) has been a topic of debate. This study sought to elucidate the causality between circulating lipids and the risk of BE and EC. We conducted two-sample Mendelian randomization (MR) analyses using single nucleotide polymorphisms (SNPs) of circulating lipids (n = 94,595 − 431,167 individuals), BE (218
-
FiTMuSiC: leveraging structural and (co)evolutionary data for protein fitness prediction Hum. Genomics (IF 4.5) Pub Date : 2024-04-16 Matsvei Tsishyn, Gabriel Cia, Pauline Hermans, Jean Kwasigroch, Marianne Rooman, Fabrizio Pucci
Systematically predicting the effects of mutations on protein fitness is essential for the understanding of genetic diseases. Indeed, predictions complement experimental efforts in analyzing how variants lead to dysfunctional proteins that in turn can cause diseases. Here we present our new fitness predictor, FiTMuSiC, which leverages structural, evolutionary and coevolutionary information. We show
-
The genetic basis of early-onset hereditary ataxia in Iran: results of a national registry of a heterogeneous population Hum. Genomics (IF 4.5) Pub Date : 2024-04-03 Nejat Mahdieh, Morteza Heidari, Zahra Rezaei, Ali Reza Tavasoli, Sareh Hosseinpour, Maryam Rasulinejad, Ali Zare Dehnavi, Masoud Ghahvechi Akbari, Reza Shervin Badv, Elahe Vafaei, Ali Mohebbi, Pouria Mohammadi, Seyyed Mohammad Mahdi Hosseiny, Reza Azizimalamiri, Ali Nikkhah, Elham Pourbakhtyaran, Mohammad Rohani, Narges Khanbanha, Sedigheh Nikbakht, Mojtaba Movahedinia, Parviz Karimi, Homa Ghabeli
To investigate the genetics of early-onset progressive cerebellar ataxia in Iran, we conducted a study at the Children’s Medical Center (CMC), the primary referral center for pediatric disorders in the country, over a three-year period from 2019 to 2022. In this report, we provide the initial findings from the national registry. We selected all early-onset patients with an autosomal recessive mode
-
Prioritizing susceptibility genes for the prognosis of male-pattern baldness with transcriptome-wide association study Hum. Genomics (IF 4.5) Pub Date : 2024-04-02 Eunyoung Choi, Jaeseung Song, Yubin Lee, Yeonbin Jeong, Wonhee Jang
Male-pattern baldness (MPB) is the most common cause of hair loss in men. It can be categorized into three types: type 2 (T2), type 3 (T3), and type 4 (T4), with type 1 (T1) being considered normal. Although various MPB-associated genetic variants have been suggested, a comprehensive study for linking these variants to gene expression regulation has not been performed to the best of our knowledge.
-
Profiling the role of m6A effectors in the regulation of pluripotent reprogramming Hum. Genomics (IF 4.5) Pub Date : 2024-04-02 Wenjun Wang, Lei Zhou, Hui Li, Tingge Sun, Xue Wen, Wei Li, Miguel A. Esteban, Andrew R. Hoffman, Ji-Fan Hu, Jiuwei Cui
The N6-methyladenosine (m6A) RNA modification plays essential roles in multiple biological processes, including stem cell fate determination. To explore the role of the m6A modification in pluripotent reprogramming, we used RNA-seq to map m6A effectors in human iPSCs, fibroblasts, and H9 ESCs, as well as in mouse ESCs and fibroblasts. By integrating the human and mouse RNA-seq data, we found that 19
-
Paternal aging impacts expression and epigenetic markers as early as the first embryonic tissue lineage differentiation Hum. Genomics (IF 4.5) Pub Date : 2024-03-26 Michelle M. Denomme, Blair R. McCallie, Mary E. Haywood, Jason C. Parks, William B. Schoolcraft, Mandy G. Katz-Jaffe
Advanced paternal age (APA) is associated with adverse outcomes to offspring health, including increased risk for neurodevelopmental disorders. The aim of this study was to investigate the methylome and transcriptome of the first two early embryonic tissue lineages, the inner cell mass (ICM) and the trophectoderm (TE), from human blastocysts in association with paternal age and disease risk. High quality
-
Clinical spectrum of Transthyretin amyloidogenic mutations among diverse population origins Hum. Genomics (IF 4.5) Pub Date : 2024-03-25 Antonella De Lillo, Gita A. Pathak, Aislinn Low, Flavio De Angelis, Sarah Abou Alaiwi, Edward J. Miller, Maria Fuciarelli, Renato Polimanti
Coding mutations in the Transthyretin (TTR) gene cause a hereditary form of amyloidosis characterized by a complex genotype-phenotype correlation with limited information regarding differences among worldwide populations. We compared 676 diverse individuals carrying TTR amyloidogenic mutations (rs138065384, Phe44Leu; rs730881165, Ala81Thr; rs121918074, His90Asn; rs76992529, Val122Ile) to 12,430 non-carriers
-
Large-scale next generation sequencing based analysis of SLCO1B1 pharmacogenetics variants in the Saudi population Hum. Genomics (IF 4.5) Pub Date : 2024-03-25 Ewa Goljan, Mohammed Abouelhoda, Asma Tahir, Mohamed ElKalioby, Brian Meyer, Dorota Monies
SLCO1B1 plays an important role in mediating hepatic clearance of many different drugs including statins, angiotensin-converting enzyme inhibitors, chemotherapeutic agents and antibiotics. Several variants in SLCO1B1 have been shown to have a clinically significant impact, in relation to efficacy of these medications. This study provides a comprehensive overview of SLCO1B1 variation in Saudi individuals
-
Structural rearrangements as a recurrent pathogenic mechanism for SETBP1 haploinsufficiency Hum. Genomics (IF 4.5) Pub Date : 2024-03-22 V. Alesi, S. Genovese, M. C. Roberti, E. Sallicandro, S. Di Tommaso, S. Loddo, V. Orlando, D. Pompili, C. Calacci, V. Mei, E. Pisaneschi, M. V. Faggiano, A. Morgia, C. Mammì, G. Astrea, R. Battini, M. Priolo, M. L. Dentici, R. Milone, A. Novelli
Chromosomal structural rearrangements consist of anomalies in genomic architecture that may or may not be associated with genetic material gain and loss. Evaluating the precise breakpoint is crucial from a diagnostic point of view, highlighting possible gene disruption and addressing to appropriate genotype–phenotype association. Structural rearrangements can either occur randomly within the genome
-
Explicable prioritization of genetic variants by integration of rule-based and machine learning algorithms for diagnosis of rare Mendelian disorders Hum. Genomics (IF 4.5) Pub Date : 2024-03-21 Ho Heon Kim, Dong-Wook Kim, Junwoo Woo, Kyoungyeul Lee
In the process of finding the causative variant of rare diseases, accurate assessment and prioritization of genetic variants is essential. Previous variant prioritization tools mainly depend on the in-silico prediction of the pathogenicity of variants, which results in low sensitivity and difficulty in interpreting the prioritization result. In this study, we propose an explainable algorithm for variant
-
Hemorrhoidal disease and its genetic association with depression, bipolar disorder, anxiety disorders, and schizophrenia: a bidirectional mendelian randomization study Hum. Genomics (IF 4.5) Pub Date : 2024-03-21 Zhiguang Huang, Jian Huang, Chun Kai Leung, Casper JP Zhang, Babatunde Akinwunmi, Wai-Kit Ming
Hemorrhoids and psychiatric disorders exhibit high prevalence rates and a tendency for relapse in epidemiological studies. Despite this, limited research has explored their correlation, and these studies are often subject to reverse causality and residual confounding. We conducted a Mendelian randomization (MR) analysis to comprehensively investigate the association between several mental illnesses
-
A genome-wide association study of neutrophil count in individuals associated to an African continental ancestry group facilitates studies of malaria pathogenesis Hum. Genomics (IF 4.5) Pub Date : 2024-03-15 Andrei-Emil Constantinescu, David A. Hughes, Caroline J. Bull, Kathryn Fleming, Ruth E. Mitchell, Jie Zheng, Siddhartha Kar, Nicholas J. Timpson, Borko Amulic, Emma E. Vincent
'Benign ethnic neutropenia' (BEN) is a heritable condition characterized by lower neutrophil counts, predominantly observed in individuals of African ancestry, and the genetic basis of BEN remains a subject of extensive research. In this study, we aimed to dissect the genetic architecture underlying neutrophil count variation through a linear-mixed model genome-wide association study (GWAS) in a population
-
Statistical methods for assessing the effects of de novo variants on birth defects Hum. Genomics (IF 4.5) Pub Date : 2024-03-14 Yuhan Xie, Ruoxuan Wu, Hongyu Li, Weilai Dong, Geyu Zhou, Hongyu Zhao
With the development of next-generation sequencing technology, de novo variants (DNVs) with deleterious effects can be identified and investigated for their effects on birth defects such as congenital heart disease (CHD). However, statistical power is still limited for such studies because of the small sample size due to the high cost of recruiting and sequencing samples and the low occurrence of DNVs
-
Cellular and clinical impact of protein phosphatase enzyme epigenetic silencing in multiple cancer tissues Hum. Genomics (IF 4.5) Pub Date : 2024-03-12 Edward Wiltshire, Manuel Castro de Moura, David Piñeyro, Ricky S. Joshi
Protein Phosphatase Enzymes (PPE) and protein kinases simultaneously control phosphorylation mechanisms that tightly regulate intracellular signalling pathways and stimulate cellular responses. In human malignancies, PPE and protein kinases are frequently mutated resulting in uncontrolled kinase activity and PPE suppression, leading to cell proliferation, migration and resistance to anti-cancer therapies
-
Zebrafish as a model to investigate a biallelic gain-of-function variant in MSGN1, associated with a novel skeletal dysplasia syndrome Hum. Genomics (IF 4.5) Pub Date : 2024-03-06 Asuman Koparir, Caroline Lekszas, Kemal Keseroglu, Thalia Rose, Lena Rappl, Aboulfazl Rad, Reza Maroofian, Nakul Narendran, Atefeh Hasanzadeh, Ehsan Ghayoor Karimiani, Felix Boschann, Uwe Kornak, Eva Klopocki, Ertuğrul M. Özbudak, Barbara Vona, Thomas Haaf, Daniel Liedtke
Rare genetic disorders causing specific congenital developmental abnormalities often manifest in single families. Investigation of disease-causing molecular features are most times lacking, although these investigations may open novel therapeutic options for patients. In this study, we aimed to identify the genetic cause in an Iranian patient with severe skeletal dysplasia and to model its molecular
-
Mutations in TSPAN12 gene causing familial exudative vitreoretinopathy Hum. Genomics (IF 4.5) Pub Date : 2024-03-01 Yuqiao Ju, Tianhui Chen, Lu Ruan, Ye Zhao, Qing Chang, Xin Huang
To report newly found TSPAN12 mutations with a unique form of familial exudative vitreoretinopathy (FEVR) and find out the possible mechanism of a repeated novel intronic variant in TSPAN12 led to FEVR. Nine TSPAN12 mutations with a unique form of FEVR were detected by panel-based NGS. MINI-Gene assay showed two splicing modes of mRNA that process two different bands A and B, and mutant-type shows
-
Combining full-length gene assay and SpliceAI to interpret the splicing impact of all possible SPINK1 coding variants Hum. Genomics (IF 4.5) Pub Date : 2024-02-27 Hao Wu, Jin-Huan Lin, Xin-Ying Tang, Gaëlle Marenne, Wen-Bin Zou, Sacha Schutz, Emmanuelle Masson, Emmanuelle Génin, Yann Fichou, Gerald Le Gac, Claude Férec, Zhuan Liao, Jian-Min Chen
Single-nucleotide variants (SNVs) within gene coding sequences can significantly impact pre-mRNA splicing, bearing profound implications for pathogenic mechanisms and precision medicine. In this study, we aim to harness the well-established full-length gene splicing assay (FLGSA) in conjunction with SpliceAI to prospectively interpret the splicing effects of all potential coding SNVs within the four-exon
-
Meta-analysis of 46,000 germline de novo mutations linked to human inherited disease Hum. Genomics (IF 4.5) Pub Date : 2024-02-23 Mónica Lopes-Marques, Matthew Mort, João Carneiro, António Azevedo, Andreia P. Amaro, David N. Cooper, Luísa Azevedo
De novo mutations (DNMs) are variants that occur anew in the offspring of noncarrier parents. They are not inherited from either parent but rather result from endogenous mutational processes involving errors of DNA repair/replication. These spontaneous errors play a significant role in the causation of genetic disorders, and their importance in the context of molecular diagnostic medicine has become
-
Plasma campesterol and ABCG5/ABCG8 gene loci on the risk of cholelithiasis and cholecystitis: evidence from Mendelian randomization and colocalization analyses Hum. Genomics (IF 4.5) Pub Date : 2024-02-12 Jiarui Mi, Qingwei Jiang, Zhengwei Qi, Zhengye Liu, Xiaoyin Bai, Xia Zheng, Jiaguo Wu, Yanfei Fang, Aiming Yang, Haotian Chen
The causal relationships between plasma metabolites and cholelithiasis/cholecystitis risks remain elusive. Using two-sample Mendelian randomization, we found that genetic proxied plasma campesterol level showed negative correlation with the risk of both cholelithiasis and cholecystitis. Furthermore, the increased risk of cholelithiasis is correlating with the increased level of plasma campesterol.
-
Altered expression of serum lncRNA CASC2 and miRNA-21-5p in COVID-19 patients Hum. Genomics (IF 4.5) Pub Date : 2024-02-12 Shymaa E. Ayoub, Olfat G. Shaker, Mohamed Masoud, Essam A. Hassan, Eman M. Ezzat, Mona I. Ahmed, Randa I. Ahmed, Amal A. Ibrahim Amin, Fadwa Abd El Reheem, Abeer A. Khalefa, Rania H. Mahmoud
Infection by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) that causes coronavirus disease 2019 (COVID-19) has a high incidence of spread. On January 30, 2020, the World Health Organization proclaimed a public health emergency of worldwide concern. More than 6.9 million deaths and more than 768 million confirmed cases had been reported worldwide as of June 18, 2023. This study included
-
Correction: Association of the C allele of rs479200 in the EGLN1 gene with COVID-19 severity in Indian population: a novel finding Hum. Genomics (IF 4.5) Pub Date : 2024-02-08 Renuka Harit, Sajal De, Piyoosh Kumar Singh, Deepika Kashyap, Manish Kumar, Dibakar Sahu, Chander Prakash Yadav, Mradul Mohan, Vineeta Singh, Ram Singh Tomar, Kailash C. Pandey, Kapil Vashisht
Correction: Human Genomics (2024) 18:7 https://doi.org/10.1186/s40246-024-00572-1 Following publication of the original article [1], the authors reported an error that the co-corresponding authorship of Dr. Kailash C Pandey has been inadvertently missed in the published version. The correct authorship has been updated in this Correction. The original article [1] has been corrected. Harit R, De S, Singh
-
Gene expression analysis reveals diabetes-related gene signatures Hum. Genomics (IF 4.5) Pub Date : 2024-02-08 M. I. Farrim, A. Gomes, D. Milenkovic, R. Menezes
Diabetes is a spectrum of metabolic diseases affecting millions of people worldwide. The loss of pancreatic β-cell mass by either autoimmune destruction or apoptosis, in type 1-diabetes (T1D) and type 2-diabetes (T2D), respectively, represents a pathophysiological process leading to insulin deficiency. Therefore, therapeutic strategies focusing on restoring β-cell mass and β-cell insulin secretory
-
Protein–protein interaction network-based integration of GWAS and functional data for blood pressure regulation analysis Hum. Genomics (IF 4.5) Pub Date : 2024-02-08 Evridiki-Pandora G. Tsare, Maria I. Klapa, Nicholas K. Moschonas
It is valuable to analyze the genome-wide association studies (GWAS) data for a complex disease phenotype in the context of the protein–protein interaction (PPI) network, as the related pathophysiology results from the function of interacting polyprotein pathways. The analysis may include the design and curation of a phenotype-specific GWAS meta-database incorporating genotypic and eQTL data linking
-
A broad wastewater screening and clinical data surveillance for virus-related diseases in the metropolitan Detroit area in Michigan Hum. Genomics (IF 4.5) Pub Date : 2024-02-06 Yabing Li, Brijen Miyani, Russell A. Faust, Randy E. David, Irene Xagoraraki
Periodic bioinformatics-based screening of wastewater for assessing the diversity of potential human viral pathogens circulating in a given community may help to identify novel or potentially emerging infectious diseases. Any identified contigs related to novel or emerging viruses should be confirmed with targeted wastewater and clinical testing. During the COVID-19 pandemic, untreated wastewater samples
-
Causal associations of COVID‐19 on neurosurgical diseases risk: a Mendelian randomization study Hum. Genomics (IF 4.5) Pub Date : 2024-02-05 Lirui Dai, Liang Lyu, Peizhi Zhou, Shu Jiang
Many researchers have explored the potential association between one neurosurgical disease and coronavirus disease 2019 (COVID-19), but few systematically analyzed the association and causality between COVID-19 and various neurosurgical diseases. A Mendelian randomization analysis was conducted to evaluate the causal association between COVID-19 (including critically ill COVID‐19, hospitalized COVID‐19
-
Polymorphisms in transcription factor binding sites and enhancer regions and pancreatic ductal adenocarcinoma risk Hum. Genomics (IF 4.5) Pub Date : 2024-02-02 Pelin Ünal, Ye Lu, Bas Bueno-de-Mesquita, Casper H. J. van Eijck, Renata Talar-Wojnarowska, Andrea Szentesi, Maria Gazouli, Edita Kreivenaite, Francesca Tavano, Ewa Małecka-Wojciesko, Bálint Erőss, Martin Oliverius, Stefania Bunduc, Mateus Nóbrega Aoki, Ludmila Vodickova, Ugo Boggi, Matteo Giaccherini, Jurate Kondrackiene, Roger Chammas, Orazio Palmieri, George E. Theodoropoulos, Maarten F. Bijlsma
Genome-wide association studies (GWAS) are a powerful tool for detecting variants associated with complex traits and can help risk stratification and prevention strategies against pancreatic ductal adenocarcinoma (PDAC). However, the strict significance threshold commonly used makes it likely that many true risk loci are missed. Functional annotation of GWAS polymorphisms is a proven strategy to identify
-
Solanidine is a sensitive and specific dietary biomarker for CYP2D6 activity Hum. Genomics (IF 4.5) Pub Date : 2024-02-01 Johanna I. Kiiski, Mikko Neuvonen, Mika Kurkela, Päivi Hirvensalo, Kreetta Hämäläinen, E. Katriina Tarkiainen, Johanna Sistonen, Mari Korhonen, Sofia Khan, Arto Orpana, Anne M. Filppula, Marko Lehtonen, Mikko Niemi
Individual assessment of CYP enzyme activities can be challenging. Recently, the potato alkaloid solanidine was suggested as a biomarker for CYP2D6 activity. Here, we aimed to characterize the sensitivity and specificity of solanidine as a CYP2D6 biomarker among Finnish volunteers with known CYP2D6 genotypes. Using non-targeted metabolomics analysis, we identified 9152 metabolite features in the fasting
-
Wastewater-based epidemiology applied at the building-level reveals distinct virome profiles based on the age of the contributing individuals Hum. Genomics (IF 4.5) Pub Date : 2024-02-01 Cristina Mejías-Molina, Anna Pico-Tomàs, Sandra Martínez-Puchol, Marta Itarte, Helena Torrell, Núria Canela, Carles M. Borrego, Lluís Corominas, Marta Rusiñol, Sílvia Bofill-Mas
Human viruses released into the environment can be detected and characterized in wastewater. The study of wastewater virome offers a consolidated perspective on the circulation of viruses within a population. Because the occurrence and severity of viral infections can vary across a person’s lifetime, studying the virome in wastewater samples contributed by various demographic segments can provide valuable
-
The effectiveness of expanded carrier screening based on next-generation sequencing for severe monogenic genetic diseases Hum. Genomics (IF 4.5) Pub Date : 2024-01-31 Xue Zhang, Qian Chen, Junnan Li, Xin Luo, Jianyun Luo, Jian Li, Ziye Zeng, Yan Wu, Hua Zhang, Yanling Dong
Expanded carrier screening (ECS) based on next-generation sequencing has been the subject of few studies to estimate the effectiveness of ECS in the Chinese population. A total of 3737 individuals from Southwest China or the general Chinese population, including 1048 pairs and 1641 individuals, were analysed by ECS for 155 monogenetic diseases. An ECS panel was used to detect 147 genes and 10,449 variants
-
Investigation of community pharmacists’ knowledge and attitudes of pharmacogenomics testing: implication for improved pharmacogenomic testing practice Hum. Genomics (IF 4.5) Pub Date : 2024-01-30 Azza Ramadan, Anan S. Jarab, Ahmad Z. Al Meslamani
Community pharmacists must be well-equipped to advance pharmacogenomics services. Nevertheless, limited data is available regarding pharmacists' knowledge and attitudes toward pharmacogenomics testing. The present study aimed to evaluate community pharmacists' knowledge and attitudes toward pharmacogenomics testing in the UAE. In this cross-sectional study, a validated, online, self-administered survey
-
Association of the C allele of rs479200 in the EGLN1 gene with COVID-19 severity in Indian population: a novel finding Hum. Genomics (IF 4.5) Pub Date : 2024-01-30 Renuka Harit, Sajal De, Piyoosh Kumar Singh, Deepika Kashyap, Manish Kumar, Dibakar Sahu, Chander Prakash Yadav, Mradul Mohan, Vineeta Singh, Ram Singh Tomar, Kailash C. Pandey, Kapil Vashisht
The present study investigated two single nucleotide polymorphisms (SNPs)—rs479200 and rs516651 in the host EGLN1/PHD2 gene for their association with COVID-19 severity. A retrospective cohort of 158 COVID-19 patients from the Indian population (March 2020 to June 2021) was enrolled. Notably, the frequency of C allele (0.664) was twofold higher than T allele (0.336) in severe COVID-19 patients. Here
-
Congenital septal defects in Karachi, Pakistan: an update of mutational screening by high-resolution melting (HRM) analysis of MTHFR C677T Hum. Genomics (IF 4.5) Pub Date : 2024-01-29 Syed Irtiza Ali, Obaid Yusuf Khan, Nadir Naveed, Hussain Ahmad, Najma Patel, Afsheen Arif
Congenital heart defects (CHDs) are the heart structural malformations present at birth. Septal defects account for 40% of CHD, including atrial, ventricular and atrioventricular septal defects. In Pakistan, the prevalence of CHD is 3.4 in 1000, and a study estimated that 60,000 babies are born with CHD annually. Methylenetetrahydrofolate reductase (MTHFR), a chief enzyme, involved in the folate metabolism
-
Evolutionary origin of germline pathogenic variants in human DNA mismatch repair genes Hum. Genomics (IF 4.5) Pub Date : 2024-01-29 Huijun Lei, Jiaheng Li, Bojin Zhao, Si Hoi Kou, Fengxia Xiao, Tianhui Chen, San Ming Wang
Mismatch repair (MMR) system is evolutionarily conserved for genome stability maintenance. Germline pathogenic variants (PVs) in MMR genes that lead to MMR functional deficiency are associated with high cancer risk. Knowing the evolutionary origin of germline PVs in human MMR genes will facilitate understanding the biological base of MMR deficiency in cancer. However, systematic knowledge is lacking
-
A genomics perspective of personalized prevention and management of obesity Hum. Genomics (IF 4.5) Pub Date : 2024-01-29 Kalliopi K. Gkouskou, Maria G. Grammatikopoulou, Evgenia Lazou, Theodora Vasilogiannakopoulou, Despina Sanoudou, Aristides G. Eliopoulos
This review discusses the landscape of personalized prevention and management of obesity from a nutrigenetics perspective. Focusing on macronutrient tailoring, we discuss the impact of genetic variation on responses to carbohydrate, lipid, protein, and fiber consumption. Our bioinformatic analysis of genomic variants guiding macronutrient intake revealed enrichment of pathways associated with circadian
-
A novel upregulated hsa_circ_0032746 regulates the oncogenesis of esophageal squamous cell carcinoma by regulating miR-4270/MCM3 axis Hum. Genomics (IF 4.5) Pub Date : 2024-01-10 Sachin Mulmi Shrestha, Xin Fang, Hui Ye, Lihua Ren, Qinghua Ji, Ruihua Shi
Circular RNAs (CircRNA) have emerged as an interest of research in recent years due to its regulatory role in various kinds of cancers of human body. Esophageal squamous cell carcinoma (ESCC) is one of the major disease subtype in Asian countries, including China. CircRNAs are formed by back-splicing covalently joined 3′- and 5′- ends rather than canonical splicing and are found to have binding affinity
-
The diversity and clinical implications of genetic variants influencing clopidogrel bioactivation and response in the Emirati population Hum. Genomics (IF 4.5) Pub Date : 2024-01-03 Lubna Q. Khasawneh, Habiba Alsafar, Hiba Alblooshi, Mushal Allam, George P. Patrinos, Bassam R. Ali
Clopidogrel is a widely prescribed prodrug that requires activation via specific pharmacogenes to exert its anti-platelet function. Genetic variations in the genes encoding its transporter, metabolizing enzymes, and target receptor lead to variability in its activation and platelet inhibition and, consequently, its efficacy. This variability increases the risk of secondary cardiovascular events, and
-
Celebrating 20 years of human genomics: a journey of discovery Hum. Genomics (IF 4.5) Pub Date : 2024-01-02 Vasilis Vasiliou
Two decades ago, Henry Stuart Publications launched the journal Human Genomics. Its enduring goal remains to promote and review genomics approaches that address key questions in biomedical research [1]. In 2012, the journal moved to BMC as its publisher, turning it into an open-access, fully online publication ensuring the published research would be shared as broadly as possible [2]. To this day,
-
SPP1 is associated with adverse prognosis and predicts immunotherapy efficacy in penile cancer Hum. Genomics (IF 4.5) Pub Date : 2023-12-19 Yuantao Zou, Xingliang Tan, Gangjun Yuan, Yi Tang, Yanjun Wang, Cong Yang, Sihao Luo, Zhiming Wu, Kai Yao
The effect of SPP1 in squamous cell carcinoma of the penis (PSCC) remained unknown. We attempted to clarify the function of the SPP1 gene in PSCC. Eight paired penile cancer specimens (including penile cancer tissue, paracancerous tissue, and positive lymph node tissue) subjected to whole transcriptome sequencing were analysed to identify differentially expressed genes. We used immunohistochemistry
-
The Human Genome Organisation (HUGO) and a vision for Ecogenomics: the Ecological Genome Project Hum. Genomics (IF 4.5) Pub Date : 2023-12-18 Benjamin Capps, Ruth Chadwick, Zohar Lederman, Tamra Lysaght, Catherine Mills, John J. Mulvihill, William S. Oetting, Ingrid Winship
The following outlines ethical reasons for widening the Human Genome Organisation’s (HUGO) mandate to include ecological genomics. The environment influences an organism’s genome through ambient factors in the biosphere (e.g. climate and UV radiation), as well as the agents it comes into contact with, i.e. the epigenetic and mutagenic effects of inanimate chemicals and pollution, and pathogenic organisms
-
What is the functional reach of wastewater surveillance for respiratory viruses, pathogenic viruses of concern, and bacterial antibiotic resistance genes of interest? Hum. Genomics (IF 4.5) Pub Date : 2023-12-18 Kevin J. Sokoloski, Rochelle H. Holm, Melissa Smith, Easton E. Ford, Eric C. Rouchka, Ted Smith
Despite a clear appreciation of the impact of human pathogens on community health, efforts to understand pathogen dynamics within populations often follow a narrow-targeted approach and rely on the deployment of specific molecular probes for quantitative detection or rely on clinical detection and reporting. Genomic analysis of wastewater samples for the broad detection of viruses, bacteria, fungi
-
Mitochondrial DNA copy number variation across three generations: a possible biomarker for assessing perinatal outcomes Hum. Genomics (IF 4.5) Pub Date : 2023-12-15 Hisanori Fukunaga, Atsuko Ikeda
Mitochondria have their own circular multi-copy genome (mtDNA), and abnormalities in the copy number are implicated in mitochondrial dysfunction, which contributes to a variety of aging-related pathologies. However, not much is known about the genetic correlation of mtDNA copy number across multiple generations and its physiological significance. We measured the mtDNA copy number in cord blood or peripheral
-
LINE-1 global DNA methylation, iron homeostasis genes, sex and age in sudden sensorineural hearing loss (SSNHL) Hum. Genomics (IF 4.5) Pub Date : 2023-12-14 Veronica Tisato, Alessandro Castiglione, Andrea Ciorba, Claudia Aimoni, Juliana Araujo Silva, Ines Gallo, Elisabetta D’Aversa, Francesca Salvatori, Chiara Bianchini, Stefano Pelucchi, Paola Secchiero, Giorgio Zauli, Ajay Vikram Singh, Donato Gemmati
Sudden sensorineural hearing loss (SSNHL) is an abrupt loss of hearing, still idiopathic in most of cases. Several mechanisms have been proposed including genetic and epigenetic interrelationships also considering iron homeostasis genes, ferroptosis and cellular stressors such as iron excess and dysfunctional mitochondrial superoxide dismutase activity. We investigated 206 SSNHL patients and 420 healthy
-
Two novel deletion mutations in β-globin gene cause β-thalassemia trait in two Chinese families Hum. Genomics (IF 4.5) Pub Date : 2023-12-08 Xiuqin Bao, Danqing Qin, Jicheng Wang, Jing Chen, Cuize Yao, Jie Liang, Kailing Liang, Yixia Wang, Yousheng Wang, Li Du, Aihua Yin
β-Thalassemia is mainly caused by point mutations in the β-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed βCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed βCD128-134) in family A and B, respectively. Both the two novel mutations
-
Whole mitogenome sequencing uncovers a relation between mitochondrial heteroplasmy and leprosy severity Hum. Genomics (IF 4.5) Pub Date : 2023-12-08 Felipe Gouvea de Souza, Moisés Batista da Silva, Gilderlanio S. de Araújo, Caio S. Silva, Andrey Henrique Gama Pinheiro, Miguel Ángel Cáceres-Durán, Mayara Natália Santana-da-Silva, Pablo Pinto, Angélica Rita Gobbo, Patrícia Fagundes da Costa, Claudio Guedes Salgado, Ândrea Ribeiro-dos-Santos, Giovanna C. Cavalcante
In recent years, the mitochondria/immune system interaction has been proposed, so that variants of mitochondrial genome and levels of heteroplasmy might deregulate important metabolic processes in fighting infections, such as leprosy. We sequenced the whole mitochondrial genome to investigate variants and heteroplasmy levels, considering patients with different clinical forms of leprosy and household
-
Triangulating nutrigenomics, metabolomics and microbiomics toward personalized nutrition and healthy living Hum. Genomics (IF 4.5) Pub Date : 2023-12-08 George Lagoumintzis, George P. Patrinos
The unique physiological and genetic characteristics of individuals influence their reactions to different dietary constituents and nutrients. This notion is the foundation of personalized nutrition. The field of nutrigenetics has witnessed significant progress in understanding the impact of genetic variants on macronutrient and micronutrient levels and the individual's responsiveness to dietary intake
-
MmisAT and MmisP: an efficient and accurate suite of variant analysis toolkit for primary mitochondrial diseases Hum. Genomics (IF 4.5) Pub Date : 2023-11-27 Shuangshuang Huang, Zhaoyu Wu, Tong Wang, Rui Yu, Zhijian Song, Hao Wang
Recent advances in next-generation sequencing (NGS) technology have greatly accelerated the need for efficient annotation to accurately interpret clinically relevant genetic variants in human diseases. Therefore, it is crucial to develop appropriate analytical tools to improve the interpretation of disease variants. Given the unique genetic characteristics of mitochondria, including haplogroup, heteroplasmy
-
Targeted sequencing of high-density SNPs provides an enhanced tool for forensic applications and genetic landscape exploration in Chinese Korean ethnic group Hum. Genomics (IF 4.5) Pub Date : 2023-11-27 Qiong Lan, Yifeng Lin, Xi Wang, Xi Yuan, Chunmei Shen, Bofeng Zhu
In this study, we present a NGS-based panel designed for sequencing 1993 SNP loci for forensic DNA investigation. This panel addresses unique challenges encountered in forensic practice and allows for a comprehensive population genetic study of the Chinese Korean ethnic group. To achieve this, we combine our results with datasets from the 1000 Genomes Project and the Human Genome Diversity Panel. We
-
A case–control comparison of acute-phase peripheral blood gene expression in participants diagnosed with minor ischaemic stroke or stroke mimics Hum. Genomics (IF 4.5) Pub Date : 2023-11-25 Joseph V. Moxon, Andrew Calcino, Ann-Katrin Kraeuter, James Phie, Georgina Anderson, Glenys Standley, Cindy Sealey, Rhondda E. Jones, Matt A. Field, Jonathan Golledge
Past studies suggest that there are changes in peripheral blood cell gene expression in response to ischaemic stroke; however, the specific changes which occur during the acute phase are poorly characterised. The current study aimed to identify peripheral blood cell genes specifically associated with the early response to ischaemic stroke using whole blood samples collected from participants diagnosed
-
Emerging trends in pharmacogenomics: from common variant associations toward comprehensive genomic profiling Hum. Genomics (IF 4.5) Pub Date : 2023-11-24 Magnus Ingelman-Sundberg, Daniel W. Nebert, Volker M. Lauschke
Some scientists say that the “dawn of pharmacogenetics” began in southern Italy, about 510 BC, when Pythagoras described a serious illness (prevalent in some families but not others) caused by “eating fava beans”; we now know this was hemolytic anemia caused by glucose-6-phosphate dehydrogenase (G6PD) deficiency, an X-linked recessive trait that affects approximately 5% of the global population [1]
-
Phenome-wide association study on miRNA-related sequence variants: the UK Biobank Hum. Genomics (IF 4.5) Pub Date : 2023-11-24 Rima Mustafa, Mohsen Ghanbari, Ville Karhunen, Marina Evangelou, Abbas Dehghan
Genetic variants in the coding region could directly affect the structure and expression levels of genes and proteins. However, the importance of variants in the non-coding region, such as microRNAs (miRNAs), remain to be elucidated. Genetic variants in miRNA-related sequences could affect their biogenesis or functionality and ultimately affect disease risk. Yet, their implications and pleiotropic
-
Dispersed DNA variants underlie hearing loss in South Florida’s minority population Hum. Genomics (IF 4.5) Pub Date : 2023-11-24 LéShon Peart, Joanna Gonzalez, Dayna Morel Swols, Duygu Duman, Turcin Saridogan, Memoona Ramzan, Mohammad Faraz Zafeer, Xue Zhong Liu, Adrien A. Eshraghi, Michael E. Hoffer, Simon I. Angeli, Guney Bademci, Susan Blanton, Carson Smith, Fred F. Telischi, Mustafa Tekin
We analyzed the genetic causes of sensorineural hearing loss in racial and ethnic minorities of South Florida by reviewing demographic, phenotypic, and genetic data on 136 patients presenting to the Hereditary Hearing Loss Clinic at the University of Miami. In our retrospective chart review, of these patients, half self-identified as Hispanic, and the self-identified racial distribution was 115 (86%)
-
The hospital Israelita Albert Einstein standards for constitutional sequence variants classification: version 2023 Hum. Genomics (IF 4.5) Pub Date : 2023-11-16 Caio Robledo D’Angioli Costa Quaio, José Ricardo Magliocco Ceroni, Michele Araújo Pereira, Anne Caroline Barbosa Teixeira, Renata Yoshiko Yamada, Vivian Pedigone Cintra, Eduardo Perrone, Marina De França, Kelin Chen, Renata Moldenhauer Minillo, Cheysa Arielly Biondo, Mariana Rezende Bandeira de Mello, Lais Rodrigues Moura, Amanda Thamires Batista do Nascimento, Karla de Oliveira Pelegrino, Larissa
Next-generation sequencing has had a significant impact on genetic disease diagnosis, but the interpretation of the vast amount of genomic data it generates can be challenging. To address this, the American College of Medical Genetics and Genomics and the Association for Molecular Pathology have established guidelines for standardized variant interpretation. In this manuscript, we present the updated
-
Identification of genetic loci jointly influencing COVID-19 and coronary heart diseases Hum. Genomics (IF 4.5) Pub Date : 2023-11-14 Siyue Wang, Hexiang Peng, Feng Chen, Chunfang Liu, Qiwen Zheng, Mengying Wang, Jiating Wang, Huan Yu, Enci Xue, Xi Chen, Xueheng Wang, Meng Fan, Xueying Qin, Yiqun Wu, Jin Li, Ying Ye, Dafang Chen, Yonghua Hu, Tao Wu
Comorbidities of coronavirus disease 2019 (COVID-19)/coronary heart disease (CHD) pose great threats to disease outcomes, yet little is known about their shared pathology. The study aimed to examine whether comorbidities of COVID-19/CHD involved shared genetic pathology, as well as to clarify the shared genetic variants predisposing risks common to COVID-19 severity and CHD risks. By leveraging publicly
-
Genetic evidence for the causal association between type 1 diabetes and the risk of polycystic ovary syndrome Hum. Genomics (IF 4.5) Pub Date : 2023-11-13 Shuwen Chen, Zaixin Guo, Qi Yu
Accumulating observational studies have identified associations between type 1 diabetes (T1D) and polycystic ovary syndrome (PCOS). Still, the evidence about the causal effect of this association is uncertain. We performed a two-sample Mendelian randomization (MR) analysis to test for the causal association between T1D and PCOS using data from a large-scale biopsy-confirmed genome-wide association
-
The burden of rare variants in DPYS gene is a novel predictor of the risk of developing severe fluoropyrimidine-related toxicity Hum. Genomics (IF 4.5) Pub Date : 2023-11-09 Elena De Mattia, Jerry Polesel, Marco Silvestri, Rossana Roncato, Lucia Scarabel, Stefano Calza, Michele Spina, Fabio Puglisi, Giuseppe Toffoli, Erika Cecchin
Despite a growing number of publications highlighting the potential impact on the therapy outcome, rare genetic variants (minor allele frequency < 1%) in genes associated to drug adsorption, distribution, metabolism, and elimination are poorly studied. Previously, rare germline DPYD missense variants were shown to identify a subset of fluoropyrimidine-treated patients at high risk for severe toxicity
-
The attitude and behaviors of the different spheres of the community of the United Arab Emirates toward the clinical utility and bioethics of secondary genetic findings: a cross-sectional study Hum. Genomics (IF 4.5) Pub Date : 2023-11-06 Azhar T. Rahma, Aminu S. Abdullahi, Giulia Graziano, Iffat Elbarazi
Genome sequencing has utility, however, it may reveal secondary findings. While Western bioethicists have been occupied with managing secondary findings, specialists’ attention in the Arabic countries has not yet been captured. We aim to explore the attitude of the United Arab Emirates (UAE) population toward secondary findings. We conducted a cross-sectional study between July and December 2022. The
-
Comprehensive analysis of alternative splicing across multiple transcriptomic cohorts reveals prognostic signatures in prostate cancer Hum. Genomics (IF 4.5) Pub Date : 2023-11-03 Zhuofan Mou, Jack Spencer, John S. McGrath, Lorna W. Harries
Alternative splicing (AS) plays a crucial role in transcriptomic diversity and is a hallmark of cancer that profoundly influences the development and progression of prostate cancer (PCa), a prevalent and potentially life-limiting cancer among men. Accumulating evidence has highlighted the association between AS dysregulation and the onset and progression of PCa. However, a comprehensive and integrative
-
Multidimensional fragmentomic profiling of cell-free DNA released from patient-derived organoids Hum. Genomics (IF 4.5) Pub Date : 2023-10-28 Jaeryuk Kim, Seung-Pyo Hong, Seyoon Lee, Woochan Lee, Dakyung Lee, Rokhyun Kim, Young Jun Park, Sungji Moon, Kyunghyuk Park, Bukyoung Cha, Jong-Il Kim
Fragmentomics, the investigation of fragmentation patterns of cell-free DNA (cfDNA), has emerged as a promising strategy for the early detection of multiple cancers in the field of liquid biopsy. However, the clinical application of this approach has been hindered by a limited understanding of cfDNA biology. Furthermore, the prevalence of hematopoietic cell-derived cfDNA in plasma complicates the in