MBL-1 and EEL-1 affect the splicing and protein levels of MEC-3 to control dendrite complexity

Jianxin Xie; Wei Zou; Madina Tugizova; Kang Shen; Xiangming Wang

doi:10.1371/journal.pgen.1010941

Abstract

Transcription factors (TFs) play critical roles in specifying many aspects of neuronal cell fate including dendritic morphology. How TFs are accurately regulated during neuronal morphogenesis is not fully understood. Here, we show that LIM homeodomain protein MEC-3, the key TF for C. elegans PVD dendrite morphogenesis, is regulated by both alternative splicing and an E3 ubiquitin ligase. The mec-3 gene generates several transcripts by alternative splicing. We find that mbl-1, the orthologue of the muscular dystrophy disease gene muscleblind-like (MBNL), is required for PVD dendrite arbor formation. Our data suggest mbl-1 regulates the alternative splicing of mec-3 to produce its long isoform. Deleting the long isoform of mec-3(deExon2) causes reduction of dendrite complexity. Through a genetic modifier screen, we find that mutation in the E3 ubiquitin ligase EEL-1 suppresses mbl-1 phenotype. eel-1 mutants also suppress mec-3(deExon2) mutant but not the mec-3 null phenotype. Loss of EEL-1 alone leads to excessive dendrite branches. Together, these results indicate that MEC-3 is fine-tuned by alternative splicing and the ubiquitin system to produce the optimal level of dendrite branches.

Author summary

Dendrite morphology is essential for the proper functioning of neurons. Abnormalities in dendrite structure are associated with different neurological disorders like autism, schizophrenia, and Rett’s syndrome. Using forward genetic approaches, we identify two new factors, alternative splicing regulator MBL-1 and E3 ubiquitin ligase EEL-1, which participate in regulating PVD dendrite morphogenesis in C. elegans. MBL-1 regulates the alternative splicing of transcription factor MEC-3 to produce its long isoform. EEL-1 reduces the amount of MEC-3 protein to ensure its correct expression level. Our findings indicate that the combination of alternative splicing and ubiquitin ligase on the level of a transcription factor to regulate dendrite morphogenesis, which is unexpected and original. Both mbl-1 and eel-1 are genes associated with diseases, and the transcription factor MEC-3 may act as their target, which will provide insight into the mechanism of these diseases.

Citation: Xie J, Zou W, Tugizova M, Shen K, Wang X (2023) MBL-1 and EEL-1 affect the splicing and protein levels of MEC-3 to control dendrite complexity. PLoS Genet 19(9): e1010941. https://doi.org/10.1371/journal.pgen.1010941

Editor: Andrew D. Chisholm, University of California San Diego, UNITED STATES

Received: December 20, 2022; Accepted: August 28, 2023; Published: September 20, 2023

Copyright: © 2023 Xie et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Data Availability: The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper and its Supporting Information files.

Funding: This work is supported by grants from the Strategic Priority Research Program of the CAS (XDB37020302 to XW), and the National Natural Science Foundation of China (31829001 to XW, 31970919 to WZ and 32000672 to XW). XW is a member of Youth Innovation Promotion Association, CAS. KS is an investigator of the Howard Hughes Medical Institute. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing interests: The authors have declared that no competing interests exist.

Introduction

Transcription factors (TFs) control gene expression and are essential for specifying different aspects of neuronal cell fate, including neurotransmitter phenotypes [1], neurite morphogenesis and membrane excitability [2–4]. Many TFs have been reported to affect dendrite morphogenesis [5–7]. For example, dendrite branching of vertebrate cortical neurons requires the notch signaling and NFkappaB [8]. Activity regulated transcription factor CREB is critical for neuronal activity induced dendritic growth and branching [9]. The homeobox TF Cux1 is required for dendritic arborization in specific cortical neuron populations [10]. In Drosophila, hamlet represses complex dendritic arbor and promotes single-dendrite morphology [11]. The development of the dendrites in the Da classes of neurons also requires other families of TFs including Abrupt, Knot, and spineless [12–14]. Different expression levels of the TF Cut specify the complexity of dendritic arborization in the four different classes of Da Neurons.

The PVD sensory neurons in C. elegans elaborate highly stereotyped and branched dendrites [15]. The PVD cell body sends one anterior and one posterior primary dendrite (1°). The secondary dendrites (2°) grow orthogonally from 1° dendrites in both ventral and dorsal directions. Upon reaching the body wall muscle borders, 2° branches turn anterior and posterior then form tertiary branches (3°) along the sub lateral nerve cords. From the 3° dendrites, numerous quaternary dendrites (4°) grow orthogonally away from the lateral midline [16]. PVD neurons sense harsh touch and cold temperature and act as nociceptors [16]. They also function as proprioceptive sensors to regulate body bend amplitude [17]. Developmentally, the complex and stereotyped dendrites are guided by the neuronal receptor DMA-1 and the epidermal adhesion molecule complex SAX-7-MNR-1-LECT-2 [18–23]. The elaborate dendritic arbor of the PVD also requires the LIM homeobox TF MEC-3 and the POU domain transcription factor UNC-86 [15,24,25]. In addition, AHR-1/spineless suppresses the dendrite branching program and prevents other neurons to adopt the PVD like dendritic arbors [25].

Alternative splicing regulates activities of transcription factors by inclusion or exclusion of exons. For example, Srp is a transcription factor involved in Drosophila mesoderm development. Two isoforms, SrpC (exclusion of N-finger) and SrpNC (inclusion of N-finger) are generated by alternative splicing, which differentially stimulate the expression of crq and gcm, respectively [26]. Muscleblind-like proteins (MBNL) belong to a family of RNA splicing regulators of precursor mRNA [27]. They regulate alternative splicing by promoting inclusion or exclusion of specific exons on different pre-mRNAs through antagonizing the activity of CUG-BP and ETR-3-like factors (CELF proteins) [28]. Pathological CUG and CCUG expansion sequesters MBNLs, leading to loss of MBNLs activity and causes myotonic dystrophy (DM) [29]. While MBNLs clearly regulate many muscle genes, in recent years, MBNLs/MBL-1 are reported to be associated with neuronal development [30–32]. However, the underlying mechanisms are not understood.

Huwe1 is a highly conserved member of the HECT E3 ubiquitin ligase family and functions in many cellular processes such as cell proliferation/suppression, embryogenesis and apoptosis [33]. In recent years, Huwe1 has been shown to degrade the N-Myc oncoprotein during nervous system development [34]. EEL-1 (the orthologue of Huwe1 in C. elegans) regulates GABAergic presynaptic transmission in C. elegans [35]. Human genetic studies show that Huwe1 is associated with multiple neurodevelopment disorders, such as X-linked mental retardation (XLMR) [36]. However, little is known about the downstream targets of Huwe1/EEL-1 in neuronal development and disorders.

Here we report that alternative splicing and proteasome degradation system contributes to the precise regulation of the key TF MEC-3. MBL-1 regulates the alternative splicing of mec-3 to produce the MEC-3 isoform with a higher branching promoting activity. Additionally, EEL-1 may directly or indirectly downregulate MEC-3’s protein level to maintain its proper expression level for PVD dendrite morphogenesis. These results demonstrate that the precise control of MEC-3 at mRNA and protein level are required for proper dendrite morphogenesis.

Results

mbl-1 mutants disrupt PVD dendrite morphology

To understand molecular mechanisms regulating PVD dendrite morphology, we carried out a candidate screen using GFP labeled PVD neuron (Fig 1A and 1B). We identified a background mutation wy888 in the strain RB1712, which showed drastically reduced dendrites and simplified arbors (Fig 1B). Through genetic mapping and sequencing, we identified the causative gene for wy888 to be mbl-1. A single point mutation was found in mbl-1, which leads to amino acid substitution of the conserved amino acid histidine to tyrosine (H131Y) (S1 Fig). Expression of wild type mbl-1 cDNA under a PVD specific promoter could rescue wy888 phenotype, indicating mbl-1 mutant causes the dendrite reduction phenotype and mbl-1 functions cell autonomously in PVD (Fig 1B–1E). To further examine this idea, we analyzed two other putative null alleles of mbl-1, tm1563 (a 513-bp deletion that eliminates the exon 3 of mbl-1) and wy560 (a 70-kb deletion that eliminates eight genes, one of which is mbl-1). The data showed that both of them led to PVD dendrite reduction phenotype (Fig 1B–1E). Interestingly, dendrite phenotype of wy888 is more severe than the two putative null alleles. The mutation in the wy888 allele (H131Y) is a conserved residue located in the zinc-knuckle-like motif CCCH (C3H) that is required for mRNA binding [37]. This point mutation might affect binding to its target mRNA and prevent the access of its target mRNA to other splicing factors.

Download:

Fig 1. mbl-1 is required for PVD dendritic morphogenesis.

(A) A cartoon showing the morphology of the PVD dendritic arbor. Primary dendrites (1°), secondary dendrites (2°), tertiary dendrites (3°), quaternary dendrites (4°). (B) Representative confocal images showing the PVD dendrite pattern, illustrated by ser-2Prom3::GFP, of young adult wild type (WT), mbl-1(wy888), mbl-1(wy888); PVD::mbl-1, mbl-1(tm1563), and mbl-1(wy560) animals. Scale bars, 50 μm. (C-E) Quantification of the number of 2°, 3°, and 4° dendrites in WT, mbl-1(wy888), mbl-1(wy888); PVD::mbl-1, mbl-1(tm1563), and mbl-1(wy560) animals. Data are shown as mean ± SEM. One-way ANOVA with Tukey’s multiple comparisons test. Not significant (NS) p>0.05, *p<0.05, ***p<0.001. n>20 for each genotype.

https://doi.org/10.1371/journal.pgen.1010941.g001

MBL-1 regulates the alternative splicing of mec-3

To identify the downstream factors of MBL-1, we constructed double mutants of mbl-1 with genes involved in PVD dendrite morphogenesis including hpo-30, dma-1, tiam-1, ire-1, and kpc-1 (S2A Fig). Unlike the other double mutants, ire-1; mbl-1 double mutant did not show a more severe dendrite phenotype compared to that of the mbl-1 single mutant, suggesting that ire-1 may be a splicing target of MBL-1. Therefore, we examined the cDNAs of ire-1 in WT and mbl-1(wy888) mutants and found no differences between these two genotypes (S2B and S2C Fig). Therefore, we do not have evidence that ire-1 is a splicing target of mbl-1.

MEC-3 functions as the vital TF to control essential downstream targets for PVD dendrite development. In mec-3 null mutant, the highly branched PVD dendritic arbors are nearly completely lost with only the unbranched primary dendrite (Fig 2A and 2B). This phenotype was similar, albeit stronger, as the phenotype of the mbl-1 mutants (wy888, tm1563, wy560), suggesting they might function in the same pathway. To test this idea, we constructed the double mutants between mec-3 and mbl-1 and the data showed that mbl-1 could not enhance mec-3 phenotype (Fig 2A and 2B). This result is consistent with the notion that they function in the same genetic pathway, and raises the hypothesis that mec-3 might be the splicing target of mbl-1.

Download:

Fig 2. mbl-1 controls PVD dendrite morphology through regulating the mec-3 exon2 exclusion.

(A) Representative confocal images showing the PVD dendrite pattern in WT, mbl-1(wy888), mec-3(wy50748), mbl-1(wy888); mec-3(wy50748), mbl-1(wy888); PVD::mec-3a (cDNA), mec-3(deExon2). Scale bars, 50 μm. (B) Quantification of 2°, 3°, and 4° dendrite number in WT, mbl-1(wy888), mec-3(wy50748), mbl-1(wy888); mec-3(wy50748), mbl-1(wy888); PVD::mec-3a (cDNA), and mec-3(deExon2) animals. Data are shown as mean ± SEM. One-way ANOVA with Tukey’s multiple comparisons test. Not significant (NS) p>0.05, ***p<0.001. n>20 for each genotype. (C) A schematic diagram showing the mec-3 genomic locus. mec-3a isoform: exon2 inclusion. mec-3d isoform: exon2 exclusion. For mec-3a isoform, using primer (L+R), RT-PCR products is 267 bp. While for the exon2 lacking d isoform, the RT-PCR products is 216 bp. (D) A representative gel of the RT-PCR products amplified from the cDNA of WT, mec-3(deExon2), mbl-1(wy888), mbl-1(tm1563), and mbl-1(wy560) animals. (E) qPCR results of mec-3a in WT, mbl-1(wy888), mbl-1(tm1563), and mbl-1(wy560) animals.

https://doi.org/10.1371/journal.pgen.1010941.g002

To test if there are changes of the mec-3 transcripts in the mbl-1 mutant, we designed primers to examine the alternative splicing of mec-3. Comparing to the wild type, the mbl-1 mutant showed different band sizes for fragments near the 5’ end of the mec-3 transcript. Specifically, in wild type the longer transcript, corresponding to the mec-3a isoform, was brighter, while the shorter transcript, corresponding to the mec-3d isoform, was dimmer. In mbl-1(wy888) mutant, the shorter transcript becomes the dominant species (Fig 2D). Sequencing experiments showed that the difference between the two isoforms was that the second exon was included in the longer mec-3a isoform and spliced out for the shorter mec-3d isoform. The second exon is 51 base pair long and would not create frameshift when it is missing. The corresponding protein sequence locates at the N-terminus of the protein, in the first LIM domain (S3 Fig), which is known to be a protein-protein interaction domain. Consistently, the two null alleles of mbl-1 mutant showed similar RT-PCR gel pattern (Fig 2D). To quantitatively assess the splicing defects, we used qRT-PCR to measure the level of the mec-3a isoform in WT, mbl-1(wy888), mbl-1(tm1563), and mbl-1(wy560) animals. The level of mec-3a isoform in wy888 allele is less than 2% of the wild type control, while the two null alleles have about 6% of the level found in the control (Fig 2E). This is consistent with the finding that the wy888 allele of mbl-1 showed more severe PVD dendrite phenotype than the two null alleles. These data suggest that mbl-1 promotes the mec-3a isoform and inhibits the mec-3d isoform. To test if MBL-1 affects known MEC-3’s transcriptional targets, we used qRT-PCR to measure the levels of acp-2, hpo-30, T24F1.4, and egl-46 [25]. The level of egl-46 transcripts is significantly lower in mbl-1(wy888) mutant (S4D Fig), whereas the other three (acp-2, hpo-30, T24F1.4) did not show significant decrease (S4A–S4C Fig). The reason might be that acp-2, hpo-30, T24F1.4 expressed in other cells beyond MEC-3-expressing cells (a few neurons) and controlled by additional transcription factors. We constructed mbl-1(wy888); egl-46(gk692) double mutants, the results showed that it could not enhance the phenotype of mbl-1(wy888) (S5A Fig), which further suggests that egl-46 and mbl-1 are in the same pathway. Overexpressing egl-46 cDNA in PVD neurons of mbl-1(wy888) mutants could rescue the phenotype slightly (S5B Fig), which support that EGL-46 functions downstream of MBL-1.

Because mbl-1 likely regulates many mRNAs, we wonder whether the reduced mec-3a is largely responsible for the PVD dendrite phenotype in the mbl-1 mutants. We used two approaches to test this idea. First, we expressed the mec-3a cDNA in the mbl-1(wy888) mutant background using a PVD specific promoter. Remarkably, this transgene largely rescued the mbl-1 mutant dendrite phenotype (Fig 2A and 2B), suggesting the mbl-1(wy888) mutant phenotype is mainly caused by the dramatically lowered level of mec-3a. It is reported that mbl-1/MBNL1 functions through consensus binding sequence GCUU [38]. In addition, we found 1 GCUU in the first intron and 3 GCUU in the second intron of mec-3, suggesting the cis-elements might be conserved.

Second, we used CRISPR-Cas9 to generate a mec-3(deExon2) allele by deleting the second exon of mec-3. By RT-PCR assay, we verified that this allele completely lacked mec-3a (Fig 2D). Indeed, mec-3(deExon2) showed dramatic reduction of dendrite complexity. This phenotype was stronger than the mbl-1 mutants but was not severe as the mec-3 null mutants (Fig 2A and 2B). These results are consistent with the fact that there are still 2–6% of the mec-3a transcripts left in the mbl-1 mutants. Together, these data indicate that the MEC-3a isoform carries the majority of MEC-3’s activity and that the lack of the mec-3a isoform in mbl-1 mutants account for their dendrite phenotypes. Compared with mec-3 null mutant, mec-3(deExon2) PVD could still elaborate some dendrite branches, suggesting that MEC-3d is partially active, likely with lower activity than MEC-3a. Indeed, overexpression of PVD driven MEC-3(deExon2) rescued the mec-3(deExon2) and CRISPR constructed mec-3(wy50748) null phenotype, suggesting that MEC-3d carries partial transcription factor activity, albeit lower than MEC-3a (Fig 3A–3D).

Download:

Fig 3. EEL-1 maintains the normal PVD dendrite through MEC-3.

(A) Representative confocal images showing the PVD dendrite pattern in mec-3(deExon2), mec-3(deExon2); eel-1(wy50785), mec-3(deExon2); PVD::mec-3(deExon2) cDNA, mec-3(wy50748), mec-3(wy50748); PVD::mec-3(deExon2), mec-3(wy50748); eel-1(wy50786). Scale bars, 50 μm. (B-D) Quantification of 2°, 3°, and 4° dendrite number in mec-3(deExon2), mec-3(deExon2); eel-1(wy50785), mec-3(deExon2); PVD::mec-3(deExon2), mec-3(wy50748), mec-3(wy50748); PVD::mec-3(deExon2) cDNA, and mec-3(wy50748); eel-1(wy50786). Data are shown as mean ± SEM. One-way ANOVA with Tukey’s multiple comparisons test. Not significant (NS) p>0.05, ***p<0.001. n>20 for each genotype.

https://doi.org/10.1371/journal.pgen.1010941.g003

In contrast to the highly branched dendrites of PVD, the other MEC-3 expressing neurons have simple, non-branched dendrites and therefore are not suitable for studying complex dendrite morphogenesis. To test if mbl-1 functions in other MEC-3 expressed neurons, we crossed mbl-1(wy888) into zdIs5 strain, which labelled the touch receptor neurons (AVM and PVM). The results showed that mbl-1 mutant did not affect the neurite morphology of AVM and PVM neurons (S6 Fig). It suggests that AVM and PVM might only requires a very low functional MEC-3 or mbl-1 might not function in these neurons at all.

E3 ligase EEL-1 mutant suppresses mbl-1(wy888) mutant phenotype not through splicing mec-3

To further understand the genetic program that regulates the mbl-1/mec-3 pathway, we performed a modifier screen on the mbl-1(wy888) mutant. From a 3000 haploid genome screen, we isolated one allele wy50554, which suppressed the dendrite reduction phenotype of mbl-1(wy888) (Fig 4A–4D). Through genetic mapping and high-seq assay, we identified a G-to-A point mutation, which causes a glutamic acid to lysine substitution in the conserved acidic domain (CAD) of the eel-1 gene. The point mutation changed an acid amino acid to alkaline amino acid (E2475K), which might disrupt the CAD function. To confirm the eel-1(wy50554) mutation is responsible for the dendrite phenotype, we constructed a putative null allele wy50784 (S7 Fig) of eel-1 using CRISPR-Cas9. Indeed, eel-1(wy50784); mbl-1(wy888) exhibited the same rescued dendrite branches as eel-1(wy50554); mbl-1(wy888) (Fig 4A–4D), indicating that inactivating eel-1 suppresses the mbl-1(wy888) phenotype.

Download:

Fig 4. E3 ligase EEL-1 mutant suppresses mbl-1(wy888) phenotype.

(A) Representative confocal images showing the PVD dendrite pattern in WT, mbl-1(wy888), eel-1(wy50554), eel-1(wy50554); mbl-1(wy888), eel-1(wy50784); mbl-1(wy888). Scale bars, 50 μm. (B-D) Quantification of 2°, 3°, and 4° dendrite number in WT, mbl-1(wy888), eel-1(wy50554), eel-1(wy50554); mbl-1(wy888), and eel-1(wy50784); mbl-1(wy888). Data are shown as mean ± SEM. One-way ANOVA with Tukey’s multiple comparisons test. Not significant (NS) p>0.05, ***p<0.001. n>20 for each genotype. (E) A representative gel of the RT-PCR products amplified from the cDNA of WT and eel-1(wy50554); mbl-1(wy888) animals.

https://doi.org/10.1371/journal.pgen.1010941.g004

As mbl-1 regulates mec-3 pre-mRNA splicing, the possible mechanism of eel-1 is to regulate mec-3 pre-mRNA splicing process. To examine this idea, we performed RT-PCR using eel-1(wy50554); mbl-1(wy888) cDNA. Interestingly, similar to mbl-1(wy888), the eel-1(wy50554); mbl-1(wy888) double mutants showed dramatically reduced mec-3a and increased mec-3d transcripts (Fig 4E), indicating eel-1 inhibition did not correct the splicing deficit in the mbl-1 mutants.

We overexpressed mec-3a isoform (full-length) cDNA in the PVD neurons of WT worms. The overexpression resulted in subtle but statistically significant increase in the number of 2°, 3°, and 4°dendrites (S8A Fig). mec-3a overexpression in eel-1(wy50554) mutation background did not further increase the dendrite branching (S8B Fig), suggesting that there is a ceiling effect of the level of MEC-3.

EEL-1 might degrade MEC-3 protein to maintain the normal PVD dendrite

To test if EEL-1 functions through MEC-3, we constructed mec-3(deExon2); eel-1(wy50785) (S7 Fig) double mutants and found that eel-1(wy50785) could suppress mec-3(deExon2) phenotype (Fig 3A–3D), suggesting eel-1 functions through mec-3. This result implies that EEL-1 may directly or indirectly regulate MEC-3 protein level. Hence, in the eel-1 mutant, it is plausible that the level of MEC-3d in the mec-3(deExon2) mutant is increased, leading to the rescue of dendrites, although this notion needed to be further confirmed.

EEL-1, a conserved E3 ubiquitin ligase, and its mammalian homolog Huwe1 have been shown to degrade TFs such as P53 and SKN-1 [39,40]. Therefore, it is conceivable that EEL-1 may degrade MEC-3 to control PVD dendrites. This hypothesis could explain the suppression of the mbl-1(wy888) phenotype by eel-1 mutations. As in mbl-1(wy888) mutant, the exon2-lacking mec-3d isoform is the main form, and protein level increase of the partially functional MEC-3(deExon2), caused by eel-1 mutant, rescued mbl-1(wy888) mutant phenotype. This is the most plausible explanation for the suppression effect of eel-1 mutant, however we still cannot completely rule out other possibilities. Actually, overexpression of PVD driven MEC-3(deExon2)/mec-3d cDNA rescued the mec-3(deExon2) and mec-3(wy50748) null phenotype (Fig 3A–3D), confirming that the protein level of MEC-3(deExon2) is positive correlation with the dendrite complexity. If EEL-1 degrades MEC-3 to control PVD dendrite morphology, we predict that eel-1 mutant could not suppress the mec-3(wy50748) null phenotype as no MEC-3 or partial functional MEC-3(deExon2) exists. Indeed, mec-3(wy50748); eel-1(wy50786) double mutant exhibited the same phenotype as mec-3(wy50748) alone (Fig 3A–3D), supporting the idea that EEL-1 degrades MEC-3. To further support this hypothesis, we examined the expression level of known MEC-3 transcription targets. As expected, all the four genes (acp-2, hpo-30, T24F1.4 and egl-46) expression increased in mbl-1(wy888); eel-1(wy50554) double mutants (S4A–S4D Fig).

To further test if EEL-1 functions as the E3 ligase to degrade MEC-3, we used CRISPR to disrupt the function of the HECT domain, which is the catalytic ubiquitin ligase domain. We isolated one frameshift mutation, a single base deletion (A11171 deletion), in mec-3(deExon2) mutant background. This mutation is immediately upstream of HECT domain and should cause a complete deletion of the HECT domain (S7 Fig). The dendrite phenotype of mec-3(deExon2) mutant was significantly suppressed (S9 Fig), indicating that the HECT ubiquitin ligase domain may be essential for eel-1’s function in suppressing mec-3(deExon2) phenotype, although we are not sure if this truncation mutant might affect EEL-1 protein stability or expression levels. The possibility of non-ubiquitin ligases mechanisms for EEL-1 function in shaping dendrite complexity can still not be ruled out.

eel-1 mutants increase the endogenous MEC-3 protein level in PVD neurons

To further verify the idea that EEL-1 controls PVD dendrite morphology through degrading MEC-3 proteins, we generated an endogenous MEC-3::GFP (GFP fused to MEC-3 before stop codon) knockin strain using the CRISPR-Cas9 technique. As expected, MEC-3::GFP localized in PVD nucleus (Fig 5A). To test if eel-1 mutants modulate endogenous MEC-3 protein level, we created three independent eel-1 knock out alleles (wy50884, wy50885, wy50886) using CRISPR-Cas9 (S7 Fig) in this MEC-3::GFP knockin strain background. Comparing the GFP fluorescence intensity with wild type, we found that the MEC-3::GFP signal was increased in all three independent eel-1 knock out strains (Fig 5B and 5C). This result is consistent with our hypothesis that the putative ubiquitin ligase EEL-1 downregulates MEC-3 to control PVD dendrite morphogenesis.

Download:

Fig 5. The E3 ligase EEL-1 regultes MEC-3 level in PVD neuron.

(A) Subcellular localization of MEC-3::GFP and PVD marker (ser-2Prom3::mCherry) in wild-type animals. Scale bar, 10 μm. (B) MEC-3::GFP protein levels of PVD neurons in WT and three independent eel-1 knock out animals. Scale bar, 10 μm. (C) Quantification of GFP fluorescence intensity in WT and the three independent eel-1 knock out animals. Data are shown as mean ± SEM. One-way ANOVA with Tukey’s multiple comparisons test. Not significant (NS) p>0.05, ***p<0.001. n>15 for each strain.

https://doi.org/10.1371/journal.pgen.1010941.g005

Discussion

While it is well appreciated that TFs specify dendrite morphology, the regulation of the TFs themselves is not well understood. In C. elegans, the key TF MEC-3 directs several downstream proteins such as HPO-30 and EGL-46 to shape PVD dendrite. How MEC-3 is regulated at mRNA and protein level is not clear.

We identified a background mutation named mbl-1(wy888) from RB1712 strain. Further investigation reveals that MBL-1 regulates the alternative splicing of mec-3. First, mbl-1 could not enhance mec-3 mutant phenotype but it does enhance hpo-30, dma-1, tiam-1, and kpc-1 phenotype (S2A Fig), suggesting mbl-1 functions in the same pathway as mec-3. Interestingly, we also found that mbl-1 could not enhance ire-1 mutant phenotype, however, we did not observe ire-1 splicing defect in mbl-1 mutant (S2B and S2C Fig). Second, the full length mec-3 cDNA (a isoform) rescued mbl-1 phenotype largely, suggesting mec-3 is the main downstream target of mbl-1 although we could not preclude any other putative targets. Third, RT-PCR results demonstrated that the ratio between the mec-3 a isoform and d isoform (lacking the second exon) was reversed with higher level of d isoform and nearly null a isoform in mbl-1 mutant, suggesting mbl-1 regulates the alternative splicing of the mec-3 second exon. Fourth, the orthologue of MBL-1 functions as alternative splicing factor and mbl-1 is reported to splice sad-1 in worm neuron [38]. Although it has been well reported that MBLN1 directly interacts with the pre-mRNA of its splicing targets in other models [41], there is still no evidence that MBL-1 binds mec-3 pre-mRNA directly in C. elegans. Interestingly, MBL-1 is also a downstream target of MEC-3 [38], indicating that a positive feedback exists between the two genes to pattern PVD dendrite.

Interestingly, the wy888 allele shows stronger phenotype than the two putative null alleles. The wy888 point mutation locates at H131, which is the conserved C3H motif binding zinc ion. One possible explanation is that the H131Y mutation likely impairs zinc binding and then affects binding between mec-3 mRNA and MBL-1(H131Y). In the two mbl-1 null alleles, MBL-1 protein is completely absent while MBL-1(H131Y) protein might still bind to mec-3 mRNA and block access of other alternative splicing factors. In fact, a previous paper showed that the C3H-type zinc finger modules containing protein Makorin competes with Bru1 for binding to the substrate osk mRNA [42].

Why is mbl-1 mutant phenotype weaker than mec-3 null mutant? We propose that the second exon lacking isoform mec-3d exhibits partial function of the full length mec-3a isoform. First, the exon 2 specific knock-out allele mec-3(deExon2) was weaker than mec-3 null allele, but stronger than mbl-1(wy888), which is probably caused by the few mec-3a isoform in mbl-1(wy888). Second, overexpression of mec-3(deExon2) construction could rescue mec-3(deExon2) and mec-3 null allele to a large extent, indicating that although the second exon-lacking mec-3d isoform is not potent as the mec-3a isoform, it does show partial function and can compensate the mec-3a isoform function when overexpressed.

Besides regulation at the mRNA level, our results also show that EEL-1, the E3 ligase, downregulates the activity of MEC-3d possibly through proteostasis, but further biochemical studies are needed to determine if MEC-3 is a definitive EEL-1 substrate. First, eel-1 suppressed mbl-1 mutant phenotype, suggesting it functions in the same pathway as mbl-1. Then it could also suppress mec-3(deExon2) phenotype, suggesting it functions through mec-3. Second, eel-1 could not suppress mec-3 null phenotype. The possible explanation is that in mec-3(null); eel-1 double mutants, no MEC-3 protein is produced and the eel-1 mutation could not increase MEC-3 level when there is no MEC-3. Therefore, eel-1 mutation could not suppress the phenotype of mec-3(null), although we could not completely exclude other possibilities. Third, eel-1 mutant exhibited more branches than the wild type, reminiscent of high level of MEC-3 protein, suggesting EEL-1 degrades MEC-3 to shape PVD dendrite. Further biochemical experiments are still needed to strengthen this hypothesis.

During PVD development, the essential TF MEC-3 should be tightly controlled. The splicing factor MBL-1 splices the second exon of mec-3 to provide enough potent mec-3a isoform to produce full functional TF MEC-3. At the same time, the MEC-3 level should be balanced by the E3 ligase EEL-1 to keep normal MEC-3 protein level, avoiding excessive branching of PVD. These elegant regulation mechanisms at post-transcriptional and post-translational ensure the proper level of MEC-3 to pattern appropriate dendrites of PVD (Fig 6A–6C).

Download:

Fig 6. Schematic model of the regulation mechanisms of dendrite morphogenesis in C. elegans PVD neuron.

(A) In wild-type animals, MBL-1 regulates the alternative splicing of mec-3, producing the great majority of mec-3a isoform and very few of the mec-3d isoform mRNAs, therefore promotes the normal dendrite matures. (B) In mbl-1 mutant, the ratio of mec-3a isoform and d isoform changes in that the d isoform is predominant, hampering the transcriptional efficiency of mec-3 downstream targets, ultimately decreasing dendrite complexity significantly. (C) In mbl-1 and eel-1 double mutants, the increased MEC-3d isoform quantity due to the E3 ligase EEL-1 mutant, although with lower transcriptional activity, restores the dendritic arbors to a WT-like morphology. Alternatively, EEL-1 functions indirectly to regulate MEC-3.

https://doi.org/10.1371/journal.pgen.1010941.g006

Many neuronal diseases have been reported to be associated with MBL-1 and EEL-1, and our findings, which the TF MEC-3 might function as their target, will enlighten the mechanism of these diseases.

Materials and methods

C. elegans strains and genetics

C. elegans strains were cultured at 20°C using nematode growth medium (NGM) plates. Escherichia coli OP50 was seeded in NGM plates. The reference strain is wild-type N2. All the mutants and transgenic strains were genetically modified based on N2.

Isolation and mapping of mutants

We isolated wy888 from RB1712 strain. Based on mbl-1(wy888); wyIs592, we isolated wy50554 by a modifier screen of 3000 haploid genomes. 50mM ethyl methanesulfonate (EMS) was used as mutagen in these two screen processes. Genetic mapping and sequencing showed that the wy888 mutant is a C-to-T point mutation in exon 4 of the mbl-1 gene, which changes a histidine to a tyrosine (c.C391T:p.H131Y). In addition, the wy50554 mutant is a G-to-A point mutation in the exon 8 of the eel-1 gene, which changes a glutamic acid to a lysine (c.G7423A:p.E2475K). SNP mapping was performed using standard methods [43].

Constructs and transgenes

Plasmid constructs were generated in pPD95.77 vector. The Clontech In-Fusion PCR Cloning System was used for vector construction and these constructs were verified by sequencing to ensure the correct results. The PCR products were amplified with Phusion DNA polymerase (New England Biolabs) or TransStart FastPfu DNA Polymerase (Transgen Biotech) by standard procedures. Standard microinjection techniques were used to generate the transgenic worms. The DNA plasmids were injected into N2, mbl-1(wy888), wyIs592, mec-3(deExon2), and mec-3(wy50748) hermaphrodites at a concentration from 10 to 50 ng/ml. 2 ng/ml Pmyo-2::mCherry plasmids were used as the co-injection marker. Knockout and knockin worms were generated by standard CRISPR/Cas9 technique. We generated mec-3(deExon2) allele by co-injection of the mixture of Peft-3_mec-3_gRNA (CRISPR-Cas9 plasmids) and repair templates, deleting the entire exon2 of mec-3 in the genome.

Fluorescent imaging

Young adult animals were anesthetized with 1 mg/ml levamisole in M9 buffer before mounted on 3% (w/v) agar pads. Images of the mec-3::GFP and the three corresponding independent eel-1 KO worms were captured in live animals at the same exposure time (2000 ms) using a 63× objective by AxioImager M2 microscope (Carl Zeiss). And images of PVD dendritic arbors of the related animals were captured by the spinning-disk confocal imaging system which includes an Axio Observer Z1 microscope (Carl Zeiss MicroImaging) equipped with a 40× objective, an electron-multiplying charge-coupled device camera (Andor), and the 488- and 568- nm lines of a Sapphire CW CDRH USB Laser System attached to a spinning-disk confocal scan head (Yokogawa CSU-X1 Spinning Disk Unit). Micro-Manager (https://micro-manager.org) software and ImageJ (http://rsbweb.nih.gov/ij/) software were used to process the images.

qRT-PCR

RNA was isolated by TriPure Isolation Reagent (Roche, catalog no.93996120) from the whole worm of mixed stages and reverse-transcribed using RT reagent kit (TaKaRa, catalog no. RR047A). mRNA expression was measured by qRT-PCR using the ΔΔCT method with the following primers: mec-3a: (forward primer, ATGGAAATGTTAGAGTCAAAG; reverse primer, CATAAATTTGCTCATTGCAGC), act-1: (forward primer, CCAGGA

ATTGCTGATCGTATG; reverse primer, GGAGAGGGAAGCGAGGATAG). acp-2: (forward primer, GAGTATCCAGAAGGGAGAAG; reverse primer,

TTAGCTCATGATCCTCGGCAG), hpo-30: (forward primer, AGATGAAGAGGCCAGAGAGC; reverse primer, GAACATGCTCCGGTCATAAAG), T24F1.4: (forward primer, CATTCGGCTAAGCAGACAAG; reverse primer, CAAAACGGCGGCGAGTAATAG), egl-46: (forward primer, TGTTCTGGAACCCAACGCTAG; reverse primer, GACTGGAGAACTGGTCACAG). Data are presented as mean ± SEM, and Student’s t-test (two-tailed distribution, two-sample unequal variance) was used to calculate P-values. Statistical significance is displayed as Not significant (NS) p>0.05, *p<0.05, **p<0.01, ***p<0.001. The tests were performed using Graphpad Prism.

Quantification and statistics

The number of 2°, 3°, and 4° dendrites of young adults was counted under the microscope using a 40× objective. The MEC-3::GFP mean intensity in the nucleus was measured by ImageJ software. All statistical tests were performed using one-way ANOVA with Tukey’s multiple comparisons test in Graphpad Prism.

Supporting information

S1 Fig. Sequence alignment of zinc finger domains between the C. elegans MBL-1, Drosophila muscleblind, and human muscleblind-like protein families.

The two C3H-type zinc finger domains are marked by underlines. A single point mutation in mbl-1(wy888) leads to histidine to tyrosine (H131Y) substitution.

https://doi.org/10.1371/journal.pgen.1010941.s001

(EPS)

S2 Fig. Genetic analysis of mbl-1 and genes regulating PVD dendrite.

(A) Double mutant analysis between mbl-1(wy888) and mutants that showed PVD dendrite phenotype. Images showing the PVD dendrite pattern in mbl-1(wy888), dma-1(wy686), mbl-1(wy888); dma-1(wy686), hpo-30(ok2047), mbl-1(wy888); hpo-30(ok2047), kpc-1(gk8), mbl-1(wy888); kpc-1(gk8), tiam-1(tm1556), mbl-1(wy888); tiam-1(tm1556), ire-1(ok799), mbl-1(wy888); ire-1(ok799). Scale bars, 50 μm. (B) A schematic diagram showing the ire-1 genomic locus. The size of RT-PCR products: primer (L1+R1), 1234 bp; primer (L2+R2), 795 bp; primer (L3+R3), 1009 bp. (C) A representative gel of the ire-1 RT-PCR products amplified from the cDNA of WT and mbl-1(wy888) animals.

https://doi.org/10.1371/journal.pgen.1010941.s002

(EPS)

S3 Fig. The second exon of MEC-3 locates at the highly conserved N-terminal portion of the LIM1 domain.

The second exon of mec-3 corresponds to AA27-43 of the MEC-3a protein. It locates at the N-terminal portion of the LIM1 domain, which is highly conserved. The exon 2 skipping will cause an in-frame deletion, which disrupts the first LIM domain.

https://doi.org/10.1371/journal.pgen.1010941.s003

(EPS)

S4 Fig. Expression level changes of the downstream target genes of MEC-3 in mbl-1(wy888) and mbl-1(wy888); eel-1(wy50554).

(A) qPCR results of acp-2 in WT, mbl-1(wy888), and mbl-1(wy888); eel-1(wy50554). (B) qPCR results of hpo-30 in WT, mbl-1(wy888), and mbl-1(wy888); eel-1(wy50554). (C) qPCR results of T24F1.4 in WT, mbl-1(wy888), and mbl-1(wy888); eel-1(wy50554). (D) qPCR results of egl-46 in WT, mbl-1(wy888), and mbl-1(wy888); eel-1(wy50554). Data are shown as mean ± SEM. One-way ANOVA with Tukey’s multiple comparisons test. Not significant (NS) p>0.05, *p<0.05, **p<0.01, ***p<0.001.

https://doi.org/10.1371/journal.pgen.1010941.s004

(EPS)

S5 Fig. egl-46 might function in the downstream of mbl-1.

(A) Images showing the PVD dendrite pattern in mbl-1(wy888), egl-46(gk692), and mbl-1(wy888); egl-46(gk692). Scale bars, 50 μm. (B) Quantification of the number of 2°, 3°, and 4° dendrites in mbl-1(wy888) and mbl-1(wy888); PVD::egl-46 animals. Data are shown as mean ± SEM. *p<0.05 by unpaired t test. n>20 for each genotype.

https://doi.org/10.1371/journal.pgen.1010941.s005

(EPS)

S6 Fig. mbl-1(wy888) mutant do not affect the neurite morphology of AVM and PVM neurons.

(A) Schematic diagram of AVM and PVM neurons in C. elegans. (B) Images showing the neurite morphology of AVM and PVM neurons in WT and mbl-1(wy888), respectively. Scale bars, 50 μm.

https://doi.org/10.1371/journal.pgen.1010941.s006

(EPS)

S7 Fig. Diagram of the mutation sites in different eel-1 alleles.

Mutation sites of eel-1(wy50554), eel-1(wy50784), eel-1(wy50785), eel-1(wy50786), eel-1(wy50884), eel-1(wy50885), eel-1(wy50886), and eel-1(wy50891) are shown in the diagram.

https://doi.org/10.1371/journal.pgen.1010941.s007

(EPS)

S8 Fig. Overexpressing mec-3a cDNA in PVD neurons increases dendrite number of WT, but not eel-1(wy50554) mutant, slightly.

(A) Quantification of the number of 2°, 3°, and 4° dendrites in WT and PVD::mec-3a animals. (B) Quantification of the number of 2°, 3°, and 4° dendrites in eel-1(wy50554) and eel-1(wy50554); PVD::mec-3a animals. Data are shown as mean ± SEM. Not significant (NS) p>0.05, *p<0.05, **p<0.01, ***p<0.001 by unpaired t test. n>20 for each genotype.

https://doi.org/10.1371/journal.pgen.1010941.s008

(EPS)

S9 Fig. The HECT ubiquitin ligase domain might be essential for eel-1’s function in suppressing mec-3(deExon2) phenotype.

(A) Schematic of the C. elegans EEL-1 protein sequences. Conserved protein domains are annotated as follows: DUF, domain of unknown function; UBA, ubiquitin-associated domain; CAD, conserved acidic domain; HECT, homologous to E6AP c-terminus domain. The HECT domain is the catalytic ubiquitin ligase domain of EEL-1 protein. In eel-1(wy50891) mutants, the HECT domain is destructed by a frameshift mutation. (B) Representative confocal images showing the PVD dendrite pattern in mec-3(deExon2) and mec-3(deExon2); eel-1(wy50891). Scale bars, 50 μm. (C) Quantification of 2°, 3°, and 4° dendrite number in mec-3(deExon2) and mec-3(deExon2); eel-1(wy50891). Data are shown as mean ± SEM. ***p < 0.001 by unpaired t test. n>30 for each genotype.

https://doi.org/10.1371/journal.pgen.1010941.s009

(EPS)

Acknowledgments

We are grateful to the Caenorhabditis Genetics Center for strains, and Prof. J. Hu, Prof. D. Li and Y. Xiang for technical help. We thank Prof. X. Wang for fosmids.

References

1. Kratsios P, Hobert O (2018) Nervous System Development: Flies and Worms Converging on Neuron Identity Control. Curr Biol 28: R1154–R1157. pmid:30300603
- View Article
- PubMed/NCBI
- Google Scholar
2. Guillemot F (2007) Spatial and temporal specification of neural fates by transcription factor codes. Development 134: 3771–3780. pmid:17898002
- View Article
- PubMed/NCBI
- Google Scholar
3. Corty MM, Tam J, Grueber WB (2016) Dendritic diversification through transcription factor-mediated suppression of alternative morphologies. Development 143: 1351–1362. pmid:27095495
- View Article
- PubMed/NCBI
- Google Scholar
4. Jan YN, Jan LY (2010) Branching out: mechanisms of dendritic arborization. Nat Rev Neurosci 11: 316–328. pmid:20404840
- View Article
- PubMed/NCBI
- Google Scholar
5. Arikkath J (2012) Molecular mechanisms of dendrite morphogenesis. Front Cell Neurosci 6: 61. pmid:23293584
- View Article
- PubMed/NCBI
- Google Scholar
6. Puram SV, Bonni A (2013) Cell-intrinsic drivers of dendrite morphogenesis. Development 140: 4657–4671. pmid:24255095
- View Article
- PubMed/NCBI
- Google Scholar
7. Santiago C, Bashaw GJ (2014) Transcription factors and effectors that regulate neuronal morphology. Development 141: 4667–4680. pmid:25468936
- View Article
- PubMed/NCBI
- Google Scholar
8. Bonini SA, Ferrari-Toninelli G, Uberti D, Montinaro M, Buizza L, et al. (2011) Nuclear factor kappaB-dependent neurite remodeling is mediated by Notch pathway. J Neurosci 31: 11697–11705.
- View Article
- Google Scholar
9. Redmond L, Kashani AH, Ghosh A (2002) Calcium regulation of dendritic growth via CaM kinase IV and CREB-mediated transcription. Neuron 34: 999–1010. pmid:12086646
- View Article
- PubMed/NCBI
- Google Scholar
10. Cubelos B, Sebastian-Serrano A, Beccari L, Calcagnotto ME, Cisneros E, et al. (2010) Cux1 and Cux2 regulate dendritic branching, spine morphology, and synapses of the upper layer neurons of the cortex. Neuron 66: 523–535. pmid:20510857
- View Article
- PubMed/NCBI
- Google Scholar
11. Moore AW, Jan LY, Jan YN (2002) hamlet, a binary genetic switch between single- and multiple- dendrite neuron morphology. Science 297: 1355–1358. pmid:12193790
- View Article
- PubMed/NCBI
- Google Scholar
12. Li W, Wang F, Menut L, Gao FB (2004) BTB/POZ-zinc finger protein abrupt suppresses dendritic branching in a neuronal subtype-specific and dosage-dependent manner. Neuron 43: 823–834. pmid:15363393
- View Article
- PubMed/NCBI
- Google Scholar
13. Hattori Y, Sugimura K, Uemura T (2007) Selective expression of Knot/Collier, a transcriptional regulator of the EBF/Olf-1 family, endows the Drosophila sensory system with neuronal class-specific elaborated dendritic patterns. Genes Cells 12: 1011–1022. pmid:17825045
- View Article
- PubMed/NCBI
- Google Scholar
14. Kim MD, Jan LY, Jan YN (2006) The bHLH-PAS protein Spineless is necessary for the diversification of dendrite morphology of Drosophila dendritic arborization neurons. Genes Dev 20: 2806–2819. pmid:17015425
- View Article
- PubMed/NCBI
- Google Scholar
15. Smith CJ, Watson JD, Spencer WC, O’Brien T, Cha B, et al. (2010) Time-lapse imaging and cell-specific expression profiling reveal dynamic branching and molecular determinants of a multi-dendritic nociceptor in C. elegans. Dev Biol 345: 18–33. pmid:20537990
- View Article
- PubMed/NCBI
- Google Scholar
16. Albeg A, Smith CJ, Chatzigeorgiou M, Feitelson DG, Hall DH, et al. (2011) C. elegans multi-dendritic sensory neurons: morphology and function. Mol Cell Neurosci 46: 308–317. pmid:20971193
- View Article
- PubMed/NCBI
- Google Scholar
17. Tao L, Porto D, Li Z, Fechner S, Lee SA, et al. (2019) Parallel Processing of Two Mechanosensory Modalities by a Single Neuron in C. elegans. Dev Cell 51: 617–631 e613.
- View Article
- Google Scholar
18. Liu OW, Shen K (2011) The transmembrane LRR protein DMA-1 promotes dendrite branching and growth in C. elegans. Nat Neurosci 15: 57–63. pmid:22138642
- View Article
- PubMed/NCBI
- Google Scholar
19. Dong X, Liu OW, Howell AS, Shen K (2013) An extracellular adhesion molecule complex patterns dendritic branching and morphogenesis. Cell 155: 296–307. pmid:24120131
- View Article
- PubMed/NCBI
- Google Scholar
20. Liang X, Dong X, Moerman DG, Shen K, Wang X (2015) Sarcomeres Pattern Proprioceptive Sensory Dendritic Endings through UNC-52/Perlecan in C. elegans. Dev Cell 33: 388–400.
- View Article
- Google Scholar
21. Salzberg Y, Diaz-Balzac CA, Ramirez-Suarez NJ, Attreed M, Tecle E, et al. (2013) Skin-derived cues control arborization of sensory dendrites in Caenorhabditis elegans. Cell 155: 308–320. pmid:24120132
- View Article
- PubMed/NCBI
- Google Scholar
22. Zou W, Shen A, Dong X, Tugizova M, Xiang YK, et al. (2016) A multi-protein receptor-ligand complex underlies combinatorial dendrite guidance choices in C. elegans. Elife 5.
- View Article
- Google Scholar
23. Zou W, Dong X, Broederdorf TR, Shen A, Kramer DA, et al. (2018) A Dendritic Guidance Receptor Complex Brings Together Distinct Actin Regulators to Drive Efficient F-Actin Assembly and Branching. Dev Cell 45: 362–375 e363. pmid:29738713
- View Article
- PubMed/NCBI
- Google Scholar
24. Tsalik EL, Niacaris T, Wenick AS, Pau K, Avery L, et al. (2003) LIM homeobox gene-dependent expression of biogenic amine receptors in restricted regions of the C. elegans nervous system. Dev Biol 263: 81–102. pmid:14568548
- View Article
- PubMed/NCBI
- Google Scholar
25. Smith CJ O’Brien T, Chatzigeorgiou M, Spencer WC, Feingold-Link E, et al. (2013) Sensory neuron fates are distinguished by a transcriptional switch that regulates dendrite branch stabilization. Neuron 79: 266–280. pmid:23889932
- View Article
- PubMed/NCBI
- Google Scholar
26. Waltzer L, Bataille L, Peyrefitte S, Haenlin M (2002) Two isoforms of Serpent containing either one or two GATA zinc fingers have different roles in Drosophila haematopoiesis. EMBO J 21: 5477–5486. pmid:12374748
- View Article
- PubMed/NCBI
- Google Scholar
27. Konieczny P, Stepniak-Konieczna E, Sobczak K (2014) MBNL proteins and their target RNAs, interaction and splicing regulation. Nucleic Acids Res 42: 10873–10887. pmid:25183524
- View Article
- PubMed/NCBI
- Google Scholar
28. Pascual M, Vicente M, Monferrer L, Artero R (2006) The Muscleblind family of proteins: an emerging class of regulators of developmentally programmed alternative splicing. Differentiation 74: 65–80. pmid:16533306
- View Article
- PubMed/NCBI
- Google Scholar
29. Sznajder LJ, Swanson MS (2019) Short Tandem Repeat Expansions and RNA-Mediated Pathogenesis in Myotonic Dystrophy. Int J Mol Sci 20. pmid:31323950
- View Article
- PubMed/NCBI
- Google Scholar
30. Lee KY, Chang HC, Seah C, Lee LJ (2019) Deprivation of Muscleblind-Like Proteins Causes Deficits in Cortical Neuron Distribution and Morphological Changes in Dendritic Spines and Postsynaptic Densities. Front Neuroanat 13: 75. pmid:31417371
- View Article
- PubMed/NCBI
- Google Scholar
31. Spilker KA, Wang GJ, Tugizova MS, Shen K (2012) Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Dev 7: 7. pmid:22314215
- View Article
- PubMed/NCBI
- Google Scholar
32. Antonacci S, Forand D, Wolf M, Tyus C, Barney J, et al. (2015) Conserved RNA-binding proteins required for dendrite morphogenesis in Caenorhabditis elegans sensory neurons. G3 (Bethesda) 5: 639–653. pmid:25673135
- View Article
- PubMed/NCBI
- Google Scholar
33. Giles AC, Grill B (2020) Roles of the HUWE1 ubiquitin ligase in nervous system development, function and disease. Neural Dev 15: 6. pmid:32336296
- View Article
- PubMed/NCBI
- Google Scholar
34. Zhao X, Heng JI, Guardavaccaro D, Jiang R, Pagano M, et al. (2008) The HECT-domain ubiquitin ligase Huwe1 controls neural differentiation and proliferation by destabilizing the N-Myc oncoprotein. Nat Cell Biol 10: 643–653. pmid:18488021
- View Article
- PubMed/NCBI
- Google Scholar
35. Opperman KJ, Mulcahy B, Giles AC, Risley MG, Birnbaum RL, et al. (2017) The HECT Family Ubiquitin Ligase EEL-1 Regulates Neuronal Function and Development. Cell Rep 19: 822–835. pmid:28445732
- View Article
- PubMed/NCBI
- Google Scholar
36. Froyen G, Corbett M, Vandewalle J, Jarvela I, Lawrence O, et al. (2008) Submicroscopic duplications of the hydroxysteroid dehydrogenase HSD17B10 and the E3 ubiquitin ligase HUWE1 are associated with mental retardation. Am J Hum Genet 82: 432–443. pmid:18252223
- View Article
- PubMed/NCBI
- Google Scholar
37. Kino Y, Mori D, Oma Y, Takeshita Y, Sasagawa N, et al. (2004) Muscleblind protein, MBNL1/EXP, binds specifically to CHHG repeats. Hum Mol Genet 13: 495–507. pmid:14722159
- View Article
- PubMed/NCBI
- Google Scholar
38. Thompson M, Bixby R, Dalton R, Vandenburg A, Calarco JA, et al. (2019) Splicing in a single neuron is coordinately controlled by RNA binding proteins and transcription factors. Elife 8.
- View Article
- Google Scholar
39. Page BD, Diede SJ, Tenlen JR, Ferguson EL (2007) EEL-1, a Hect E3 ubiquitin ligase, controls asymmetry and persistence of the SKN-1 transcription factor in the early C. elegans embryo. Development 134: 2303–2314. pmid:17537795
- View Article
- PubMed/NCBI
- Google Scholar
40. Chen D, Kon N, Li M, Zhang W, Qin J, et al. (2005) ARF-BP1/Mule is a critical mediator of the ARF tumor suppressor. Cell 121: 1071–1083. pmid:15989956
- View Article
- PubMed/NCBI
- Google Scholar
41. Warf MB, Diegel JV, von Hippel PH, Berglund JA (2009) The protein factors MBNL1 and U2AF65 bind alternative RNA structures to regulate splicing. Proc Natl Acad Sci U S A 106: 9203–9208. pmid:19470458
- View Article
- PubMed/NCBI
- Google Scholar
42. Dold A, Han H, Liu N, Hildebrandt A, Bruggemann M, et al. (2020) Makorin 1 controls embryonic patterning by alleviating Bruno1-mediated repression of oskar translation. PLoS Genet 16: e1008581. pmid:31978041
- View Article
- PubMed/NCBI
- Google Scholar
43. Davis MW, Hammarlund M, Harrach T, Hullett P, Olsen S, et al. (2005) Rapid single nucleotide polymorphism mapping in C. elegans. BMC Genomics 6: 118. pmid:16156901
- View Article
- PubMed/NCBI
- Google Scholar

[ref1] 1. Kratsios P, Hobert O (2018) Nervous System Development: Flies and Worms Converging on Neuron Identity Control. Curr Biol 28: R1154–R1157. pmid:30300603
View Article
PubMed/NCBI
Google Scholar

[2] View Article

[3] PubMed/NCBI

[4] Google Scholar

[ref2] 2. Guillemot F (2007) Spatial and temporal specification of neural fates by transcription factor codes. Development 134: 3771–3780. pmid:17898002
View Article
PubMed/NCBI
Google Scholar

[6] View Article

[7] PubMed/NCBI

[8] Google Scholar

[ref3] 3. Corty MM, Tam J, Grueber WB (2016) Dendritic diversification through transcription factor-mediated suppression of alternative morphologies. Development 143: 1351–1362. pmid:27095495
View Article
PubMed/NCBI
Google Scholar

[10] View Article

[11] PubMed/NCBI

[12] Google Scholar

[ref4] 4. Jan YN, Jan LY (2010) Branching out: mechanisms of dendritic arborization. Nat Rev Neurosci 11: 316–328. pmid:20404840
View Article
PubMed/NCBI
Google Scholar

[14] View Article

[15] PubMed/NCBI

[16] Google Scholar

[ref5] 5. Arikkath J (2012) Molecular mechanisms of dendrite morphogenesis. Front Cell Neurosci 6: 61. pmid:23293584
View Article
PubMed/NCBI
Google Scholar

[18] View Article

[19] PubMed/NCBI

[20] Google Scholar

[ref6] 6. Puram SV, Bonni A (2013) Cell-intrinsic drivers of dendrite morphogenesis. Development 140: 4657–4671. pmid:24255095
View Article
PubMed/NCBI
Google Scholar

[22] View Article

[23] PubMed/NCBI

[24] Google Scholar

[ref7] 7. Santiago C, Bashaw GJ (2014) Transcription factors and effectors that regulate neuronal morphology. Development 141: 4667–4680. pmid:25468936
View Article
PubMed/NCBI
Google Scholar

[26] View Article

[27] PubMed/NCBI

[28] Google Scholar

[ref8] 8. Bonini SA, Ferrari-Toninelli G, Uberti D, Montinaro M, Buizza L, et al. (2011) Nuclear factor kappaB-dependent neurite remodeling is mediated by Notch pathway. J Neurosci 31: 11697–11705.
View Article
Google Scholar

[30] View Article

[31] Google Scholar

[ref9] 9. Redmond L, Kashani AH, Ghosh A (2002) Calcium regulation of dendritic growth via CaM kinase IV and CREB-mediated transcription. Neuron 34: 999–1010. pmid:12086646
View Article
PubMed/NCBI
Google Scholar

[33] View Article

[34] PubMed/NCBI

[35] Google Scholar

[ref10] 10. Cubelos B, Sebastian-Serrano A, Beccari L, Calcagnotto ME, Cisneros E, et al. (2010) Cux1 and Cux2 regulate dendritic branching, spine morphology, and synapses of the upper layer neurons of the cortex. Neuron 66: 523–535. pmid:20510857
View Article
PubMed/NCBI
Google Scholar

[37] View Article

[38] PubMed/NCBI

[39] Google Scholar

[ref11] 11. Moore AW, Jan LY, Jan YN (2002) hamlet, a binary genetic switch between single- and multiple- dendrite neuron morphology. Science 297: 1355–1358. pmid:12193790
View Article
PubMed/NCBI
Google Scholar

[41] View Article

[42] PubMed/NCBI

[43] Google Scholar

[ref12] 12. Li W, Wang F, Menut L, Gao FB (2004) BTB/POZ-zinc finger protein abrupt suppresses dendritic branching in a neuronal subtype-specific and dosage-dependent manner. Neuron 43: 823–834. pmid:15363393
View Article
PubMed/NCBI
Google Scholar

[45] View Article

[46] PubMed/NCBI

[47] Google Scholar

[ref13] 13. Hattori Y, Sugimura K, Uemura T (2007) Selective expression of Knot/Collier, a transcriptional regulator of the EBF/Olf-1 family, endows the Drosophila sensory system with neuronal class-specific elaborated dendritic patterns. Genes Cells 12: 1011–1022. pmid:17825045
View Article
PubMed/NCBI
Google Scholar

[49] View Article

[50] PubMed/NCBI

[51] Google Scholar

[ref14] 14. Kim MD, Jan LY, Jan YN (2006) The bHLH-PAS protein Spineless is necessary for the diversification of dendrite morphology of Drosophila dendritic arborization neurons. Genes Dev 20: 2806–2819. pmid:17015425
View Article
PubMed/NCBI
Google Scholar

[53] View Article

[54] PubMed/NCBI

[55] Google Scholar

[ref15] 15. Smith CJ, Watson JD, Spencer WC, O’Brien T, Cha B, et al. (2010) Time-lapse imaging and cell-specific expression profiling reveal dynamic branching and molecular determinants of a multi-dendritic nociceptor in C. elegans. Dev Biol 345: 18–33. pmid:20537990
View Article
PubMed/NCBI
Google Scholar

[57] View Article

[58] PubMed/NCBI

[59] Google Scholar

[ref16] 16. Albeg A, Smith CJ, Chatzigeorgiou M, Feitelson DG, Hall DH, et al. (2011) C. elegans multi-dendritic sensory neurons: morphology and function. Mol Cell Neurosci 46: 308–317. pmid:20971193
View Article
PubMed/NCBI
Google Scholar

[61] View Article

[62] PubMed/NCBI

[63] Google Scholar

[ref17] 17. Tao L, Porto D, Li Z, Fechner S, Lee SA, et al. (2019) Parallel Processing of Two Mechanosensory Modalities by a Single Neuron in C. elegans. Dev Cell 51: 617–631 e613.
View Article
Google Scholar

[65] View Article

[66] Google Scholar

[ref18] 18. Liu OW, Shen K (2011) The transmembrane LRR protein DMA-1 promotes dendrite branching and growth in C. elegans. Nat Neurosci 15: 57–63. pmid:22138642
View Article
PubMed/NCBI
Google Scholar

[68] View Article

[69] PubMed/NCBI

[70] Google Scholar

[ref19] 19. Dong X, Liu OW, Howell AS, Shen K (2013) An extracellular adhesion molecule complex patterns dendritic branching and morphogenesis. Cell 155: 296–307. pmid:24120131
View Article
PubMed/NCBI
Google Scholar

[72] View Article

[73] PubMed/NCBI

[74] Google Scholar

[ref20] 20. Liang X, Dong X, Moerman DG, Shen K, Wang X (2015) Sarcomeres Pattern Proprioceptive Sensory Dendritic Endings through UNC-52/Perlecan in C. elegans. Dev Cell 33: 388–400.
View Article
Google Scholar

[76] View Article

[77] Google Scholar

[ref21] 21. Salzberg Y, Diaz-Balzac CA, Ramirez-Suarez NJ, Attreed M, Tecle E, et al. (2013) Skin-derived cues control arborization of sensory dendrites in Caenorhabditis elegans. Cell 155: 308–320. pmid:24120132
View Article
PubMed/NCBI
Google Scholar

[79] View Article

[80] PubMed/NCBI

[81] Google Scholar

[ref22] 22. Zou W, Shen A, Dong X, Tugizova M, Xiang YK, et al. (2016) A multi-protein receptor-ligand complex underlies combinatorial dendrite guidance choices in C. elegans. Elife 5.
View Article
Google Scholar

[83] View Article

[84] Google Scholar

[ref23] 23. Zou W, Dong X, Broederdorf TR, Shen A, Kramer DA, et al. (2018) A Dendritic Guidance Receptor Complex Brings Together Distinct Actin Regulators to Drive Efficient F-Actin Assembly and Branching. Dev Cell 45: 362–375 e363. pmid:29738713
View Article
PubMed/NCBI
Google Scholar

[86] View Article

[87] PubMed/NCBI

[88] Google Scholar

[ref24] 24. Tsalik EL, Niacaris T, Wenick AS, Pau K, Avery L, et al. (2003) LIM homeobox gene-dependent expression of biogenic amine receptors in restricted regions of the C. elegans nervous system. Dev Biol 263: 81–102. pmid:14568548
View Article
PubMed/NCBI
Google Scholar

[90] View Article

[91] PubMed/NCBI

[92] Google Scholar

[ref25] 25. Smith CJ O’Brien T, Chatzigeorgiou M, Spencer WC, Feingold-Link E, et al. (2013) Sensory neuron fates are distinguished by a transcriptional switch that regulates dendrite branch stabilization. Neuron 79: 266–280. pmid:23889932
View Article
PubMed/NCBI
Google Scholar

[94] View Article

[95] PubMed/NCBI

[96] Google Scholar

[ref26] 26. Waltzer L, Bataille L, Peyrefitte S, Haenlin M (2002) Two isoforms of Serpent containing either one or two GATA zinc fingers have different roles in Drosophila haematopoiesis. EMBO J 21: 5477–5486. pmid:12374748
View Article
PubMed/NCBI
Google Scholar

[98] View Article

[99] PubMed/NCBI

[100] Google Scholar

[ref27] 27. Konieczny P, Stepniak-Konieczna E, Sobczak K (2014) MBNL proteins and their target RNAs, interaction and splicing regulation. Nucleic Acids Res 42: 10873–10887. pmid:25183524
View Article
PubMed/NCBI
Google Scholar

[102] View Article

[103] PubMed/NCBI

[104] Google Scholar

[ref28] 28. Pascual M, Vicente M, Monferrer L, Artero R (2006) The Muscleblind family of proteins: an emerging class of regulators of developmentally programmed alternative splicing. Differentiation 74: 65–80. pmid:16533306
View Article
PubMed/NCBI
Google Scholar

[106] View Article

[107] PubMed/NCBI

[108] Google Scholar

[ref29] 29. Sznajder LJ, Swanson MS (2019) Short Tandem Repeat Expansions and RNA-Mediated Pathogenesis in Myotonic Dystrophy. Int J Mol Sci 20. pmid:31323950
View Article
PubMed/NCBI
Google Scholar

[110] View Article

[111] PubMed/NCBI

[112] Google Scholar

[ref30] 30. Lee KY, Chang HC, Seah C, Lee LJ (2019) Deprivation of Muscleblind-Like Proteins Causes Deficits in Cortical Neuron Distribution and Morphological Changes in Dendritic Spines and Postsynaptic Densities. Front Neuroanat 13: 75. pmid:31417371
View Article
PubMed/NCBI
Google Scholar

[114] View Article

[115] PubMed/NCBI

[116] Google Scholar

[ref31] 31. Spilker KA, Wang GJ, Tugizova MS, Shen K (2012) Caenorhabditis elegans Muscleblind homolog mbl-1 functions in neurons to regulate synapse formation. Neural Dev 7: 7. pmid:22314215
View Article
PubMed/NCBI
Google Scholar

[118] View Article

[119] PubMed/NCBI

[120] Google Scholar

[ref32] 32. Antonacci S, Forand D, Wolf M, Tyus C, Barney J, et al. (2015) Conserved RNA-binding proteins required for dendrite morphogenesis in Caenorhabditis elegans sensory neurons. G3 (Bethesda) 5: 639–653. pmid:25673135
View Article
PubMed/NCBI
Google Scholar

[122] View Article

[123] PubMed/NCBI

[124] Google Scholar

[ref33] 33. Giles AC, Grill B (2020) Roles of the HUWE1 ubiquitin ligase in nervous system development, function and disease. Neural Dev 15: 6. pmid:32336296
View Article
PubMed/NCBI
Google Scholar

[126] View Article

[127] PubMed/NCBI

[128] Google Scholar

[ref34] 34. Zhao X, Heng JI, Guardavaccaro D, Jiang R, Pagano M, et al. (2008) The HECT-domain ubiquitin ligase Huwe1 controls neural differentiation and proliferation by destabilizing the N-Myc oncoprotein. Nat Cell Biol 10: 643–653. pmid:18488021
View Article
PubMed/NCBI
Google Scholar

[130] View Article

[131] PubMed/NCBI

[132] Google Scholar

[ref35] 35. Opperman KJ, Mulcahy B, Giles AC, Risley MG, Birnbaum RL, et al. (2017) The HECT Family Ubiquitin Ligase EEL-1 Regulates Neuronal Function and Development. Cell Rep 19: 822–835. pmid:28445732
View Article
PubMed/NCBI
Google Scholar

[134] View Article

[135] PubMed/NCBI

[136] Google Scholar

[ref36] 36. Froyen G, Corbett M, Vandewalle J, Jarvela I, Lawrence O, et al. (2008) Submicroscopic duplications of the hydroxysteroid dehydrogenase HSD17B10 and the E3 ubiquitin ligase HUWE1 are associated with mental retardation. Am J Hum Genet 82: 432–443. pmid:18252223
View Article
PubMed/NCBI
Google Scholar

[138] View Article

[139] PubMed/NCBI

[140] Google Scholar

[ref37] 37. Kino Y, Mori D, Oma Y, Takeshita Y, Sasagawa N, et al. (2004) Muscleblind protein, MBNL1/EXP, binds specifically to CHHG repeats. Hum Mol Genet 13: 495–507. pmid:14722159
View Article
PubMed/NCBI
Google Scholar

[142] View Article

[143] PubMed/NCBI

[144] Google Scholar

[ref38] 38. Thompson M, Bixby R, Dalton R, Vandenburg A, Calarco JA, et al. (2019) Splicing in a single neuron is coordinately controlled by RNA binding proteins and transcription factors. Elife 8.
View Article
Google Scholar

[146] View Article

[147] Google Scholar

[ref39] 39. Page BD, Diede SJ, Tenlen JR, Ferguson EL (2007) EEL-1, a Hect E3 ubiquitin ligase, controls asymmetry and persistence of the SKN-1 transcription factor in the early C. elegans embryo. Development 134: 2303–2314. pmid:17537795
View Article
PubMed/NCBI
Google Scholar

[149] View Article

[150] PubMed/NCBI

[151] Google Scholar

[ref40] 40. Chen D, Kon N, Li M, Zhang W, Qin J, et al. (2005) ARF-BP1/Mule is a critical mediator of the ARF tumor suppressor. Cell 121: 1071–1083. pmid:15989956
View Article
PubMed/NCBI
Google Scholar

[153] View Article

[154] PubMed/NCBI

[155] Google Scholar

[ref41] 41. Warf MB, Diegel JV, von Hippel PH, Berglund JA (2009) The protein factors MBNL1 and U2AF65 bind alternative RNA structures to regulate splicing. Proc Natl Acad Sci U S A 106: 9203–9208. pmid:19470458
View Article
PubMed/NCBI
Google Scholar

[157] View Article

[158] PubMed/NCBI

[159] Google Scholar

[ref42] 42. Dold A, Han H, Liu N, Hildebrandt A, Bruggemann M, et al. (2020) Makorin 1 controls embryonic patterning by alleviating Bruno1-mediated repression of oskar translation. PLoS Genet 16: e1008581. pmid:31978041
View Article
PubMed/NCBI
Google Scholar

[161] View Article

[162] PubMed/NCBI

[163] Google Scholar

[ref43] 43. Davis MW, Hammarlund M, Harrach T, Hullett P, Olsen S, et al. (2005) Rapid single nucleotide polymorphism mapping in C. elegans. BMC Genomics 6: 118. pmid:16156901
View Article
PubMed/NCBI
Google Scholar

[165] View Article

[166] PubMed/NCBI

[167] Google Scholar

Figures

Abstract

Author summary

Introduction

Results

mbl-1 mutants disrupt PVD dendrite morphology

MBL-1 regulates the alternative splicing of mec-3

E3 ligase EEL-1 mutant suppresses mbl-1(wy888) mutant phenotype not through splicing mec-3

EEL-1 might degrade MEC-3 protein to maintain the normal PVD dendrite

eel-1 mutants increase the endogenous MEC-3 protein level in PVD neurons

Discussion

Materials and methods

C. elegans strains and genetics

Isolation and mapping of mutants

Constructs and transgenes

Fluorescent imaging

qRT-PCR

Quantification and statistics

Supporting information

S1 Fig. Sequence alignment of zinc finger domains between the C. elegans MBL-1, Drosophila muscleblind, and human muscleblind-like protein families.

S2 Fig. Genetic analysis of mbl-1 and genes regulating PVD dendrite.

S3 Fig. The second exon of MEC-3 locates at the highly conserved N-terminal portion of the LIM1 domain.

S4 Fig. Expression level changes of the downstream target genes of MEC-3 in mbl-1(wy888) and mbl-1(wy888); eel-1(wy50554).

S5 Fig. egl-46 might function in the downstream of mbl-1.

S6 Fig. mbl-1(wy888) mutant do not affect the neurite morphology of AVM and PVM neurons.

S7 Fig. Diagram of the mutation sites in different eel-1 alleles.

S8 Fig. Overexpressing mec-3a cDNA in PVD neurons increases dendrite number of WT, but not eel-1(wy50554) mutant, slightly.

S9 Fig. The HECT ubiquitin ligase domain might be essential for eel-1’s function in suppressing mec-3(deExon2) phenotype.

Acknowledgments

References