Introduction

Multiple myeloma (MM) is the second hematologic malignancy, in which an increased proliferation of plasma cells results in a multiple myeloma plasma cells secrete abnormal immunoglobulin [1]. The expansion of plasma cells of B-cell lineage in MM affects their interactions with the bone marrow components. It leads to pathobiological phenotypes, including escalated expression of the β3-integrin and the cellular surface of receptors, plasma cell dissemination, the prevention of apoptosis, adhesion to the ECM, and the development of capillaries [2]. Instead of producing immunoglobulin G or A by normal plasma cells, the malignant cells generate significant quantities of M protein since they don’t experience isotype switching [3].

There are some therapeutic options to prolong patients’ survival, namely stem cell transplantation, chemotherapy, and targeted drug therapy. Proteasome inhibitors (PIs) are among the most common treatments for multiple myeloma [4]. An example of proteasome inhibitors is bortezomib (BTZ) which drives myeloma cells to die by the apoptosis pathway, but patients ultimately develop resistance to apoptosis [5]. Patients with a relapsed malignancy face more aggressive phenotypes which cannot be cured easily because of their shorter response duration and drug resistance [6].

PI-resistant cells have higher mitochondrial protein expression and activity. These modifications increase oxidative phosphorylation and reduce unfolded proteins to some extent [7]. The reduction of unfold proteins in the resistant myeloma cancer cells culminates in the lower transcription of genes involved in the IRE1-XBP1 pathway [8]. This signaling cascade controls pivotal genes that affect the immune system and cellular response to stresses during a process called unfolded protein response (UPR) [9]. Increased expression of XBP1 and activation of UPR are hallmarks of MM and play a critical role in patients’ prognosis [10].

UPR is a kind of stress response activated by the accumulation of unfolded or misfolded proteins in the endoplasmic reticulum organelle, enhancing the proper folding of proteins for the sake of apoptosis prevention [11]. XBP1 is a transcription factor encoded by the xbp1 (22q12.1) gene. XBP1 protein increase UPR induced by unfolded proteins [12]. The IRE1 protein is encoded by the ern1 gene and is located on the surface of the outer membrane of the endoplasmic reticulum ER. This protein has kinase and endoribonuclease activity, responding to stress signals in the endoplasmic reticulum [13]. A common attribute of PI-resistant myeloma cells is low levels of IRE1, XBP1, and UPR genes [14]. Downregulation of IRE1 and XBP1 transcription may promote PI resistance, while upregulation of these genes might provide a potential therapeutic approach to target PI-resistant myeloma. MicroRNAs (miRNAs) as short non-coding RNAs, regulate various target genes after the transcription stage and are linked to a variety of pathological processes [15]. It is shown that microRNAs, such as hsa-miR-34c-5p, hsa-miR-214, and hsa-miR-30c-2* have the ability to regulate XBP1 expression [16,17,18].

In addition, miR-34c has the ability to bind to the 3′ untranslated region (UTR) of the Bcl2 gene and adjust it [19]. Previous studies suggested that miR-34c plays a key role in normal cell phenotype. While miR-34c is downregulated in some types of cancers, such as osteosarcomas and gliomas, its overexpression has been reported in other pathological conditions [20].

The current study aimed to compare the expression profiles of the abovementioned microRNAs between clinically resistant and susceptible cells to the proteasome inhibitor (bortezomib). Furthermore, to explore the impacts of hsa-miR-34c-5p on BAX/BCL2 pathways, we blocked it in PI-resistant myeloma cells and studied subsequent changes. It is revealed that hsa-miR-34c-5p blockage affects the expression of Bax and Bcl2 genes and drives cells to the apoptosis path through counteracting cell resistance.

Methods

Establishment of MM Cells Resistant to Bortezomib

The human MM cell line of U266B1 was supplied from the National Cell Bank of Iran (NCBI), established by the Pasteur Institute of Iran. Cells were cultured in RPMI 1640 Hepes medium (Bioidea Company, Iran) supplemented with 10% Fetal Bovine Serum (FBS; Bioidea Company, Iran) and 1% penicillin and streptomycin antibiotics (100 U/mL of each; Bioidea Company, Iran). The incubation condition was adjusted at 37℃, 5% CO2, and 95% humidity.

The bortezomib drug was purchased as a lyophilized powder (Sobhan oncology, Iran) and solved in DMSO to generate 5 mM stock. The cultures were passaged when the density ratio was above 80%. U266B1 cells were steadily subjected to an increasing dose of bortezomib (during a time period of 6–8 months) to produce bortezomib-resistant MM cells. Following one week of exposure to the lowest concentration of BTZ (2.5 nM), cells were cultured in a drug-free medium for stabilization. Then, the stronger dose of the drug was applied to the cells. Concentrations constituted of six various quantities ranging from 2.5 nM to 40 nM.

Cell Viability Assessment

To prepare the MTT solution, we dissolved 50 mg of its powder in 10 ml of culture medium. Fresh working solutions were always used for the assessment. The cell concentration was obtained by the trypan blue method (Sigma, USA) [21]. About 10,000 cells were transferred to 96-well plates in the final volume of 100 μl per well (90 μl of culture medium). The plate was incubated for 24 h in the incubator to allow the cells to adhere to the plate. Then 50 µl of the MTT solution was added to each well. The absorbance of the samples was measured at 570 nm using the ELISA reader (BioTek ELx800, USA).

After MTT assay to prove cell resistance, IC50 (concentration of drug that inhibits 50% of cell growth relative to control sample) of cells was calculated. The parameter was defined using nonlinear regression equations of cell growth curves against drug concentrations in the GraphPad Prism statistical program for each resistant and sensitive cell.

RNA Extraction and cDNA Synthesis

Total RNA extraction from sensitive and resistant MM cell lines was performed using the Favorgen company kit (Taiwan). To evaluate the purity and concentration of extracted RNAs, we determined each sample's optical density (OD) by the ratio of absorbance at 260 nm and 280 nm. Besides, the quality of the extracted RNAs was verified by gel electrophoresis. Consequently, the cDNAs were synthesized by the cDNA synthesis Kit (YTA, Iran).

Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

The synthesized cDNAs were subjected to real-time PCR reactions to determine the expression level of XBP1 and miRNAs. The required primers were designed by AlleleID software (USA) and were provided by the AnaCell company (Iran). We used the SYBR Green qPCR MasterMix kit (YTA, Iran), considering the GAPDH gene as an internal control. In addition, the test was simultaneously performed on U6 RNA as the internal control gene to normalize the miRNAs' expression. The experiments’ conditions for cDNA synthesis and real-time PCR procedures are mentioned in the supplementary material.

MiR-34c-5p Inhibition

The sequence of mir-34c-5p was obtained from miRBase (accession code: MIMAT0036575; AGGCAGUGUAGUUAGCUGAUUGC). In order to reduce the level of miR-34c-5p in our cells, we considered inhibitor oligonucleotide of miR-34c-5p along with its control provided by Anacelltec (Iran). The transfection reagent Lipofectamine 3000 (Invitrogen, USA) with the plasmid (pcDNA3.1 +) was used to transfect the resistant cells.

Statistical Analysis

The triplicate real-time PCR approach was considered to improve the accuracy. Thus, the presented data results from the Mean ± SD of three separate samples. The level of each gene was compared to GAPDH and U6 internal controls. An independent t-test evaluated the groups' significant differences (SD) by GraphPad Prism version 8.0 (San Diego, USA). The p values < 0.05 were considered a statistically significant difference.

Results

Generation of Resistant Cells and MMT Assay

To treat the MM cell line, we use a progressively elevated dosage of bortezomib. The growth rate of cells without receiving bortezomib (sensitive cells) was significantly higher than the treated cells.

It is essential to calculate IC50 for each group and compare them to confirm the establishment of the resistant cell. It was found that a concentration of 80 nM of bortezomib significantly reduces the cell survival rate in treated cells with bortezomib compared to the control group (P < 0.001). The concentration was higher than IC50 (42.4 nM), and this significant decrease continued with an increasing dose of bortezomib. Therefore, a concentration of 40 nM was considered to study the expression of genes.

However, the IC50 calculated by GraphPad Prism software for the sensitive cell was equal to 23.67 nM. The illustration depicted that drug administration on sensitive and treated cells influenced their viability rate to varying degrees (Fig. 1). The difference between the two groups confirmed the establishment of resistant cells.

Fig. 1
figure 1

Results of MMT assessment for treated and sensitive cell lines. A. The survival rate of treated cells with different concentrations of bortezomib for 24 h. B. The survival rate for sensitive cells exposed to various drug concentrations during 24 h. Results are shown as Mean ± standard error of the mean (SEM) (** p < 0.01, *** p < 0.001, **** p < 0.0001)

Full size image

Quality of Extracted RNAs

The highest concentration among the extracted RNAs was 240 ng/μl and the lowest concentration was 170 ng/μl. Gel electrophoresis of the extracted RNAs showed sharp bands for 28s rRNA and 18s rRNA. As a result, the samples were intact and had not degraded components (Fig. 2).

Fig. 2
figure 2

Two bands of 28S rRNA and 18S rRNA in agarose gel electrophoresis confirmed the quality of extracted RNA

Full size image

Differential Expression of MicroRNAs and Genes

In this study, the relative expression of XBP1 gene in resistant and sensitive U266 cell lines was evaluated and GAPDH was considered as a control in each experiment. The results showed that the expression of XBP1 gene in resistant cells (BTZ40 nm) was significantly reduced in comparison to the sensitive cells. Furthermore, the level of miR-34c-5p in the treated and sensitive cells was measured by real-time PCR and U6 was used as the reference gene. According to the results, there is a significant difference in its expression in resistant and sensitive cells. However, the expression profile of miR-214 and miR-30c-2* showed no considerable variation in the two cell lines (Fig. 3).

Fig. 3
figure 3

A XBP1, B miR-214, C miR-34c-5p, D miR30c-2* expression in the presence of bortezomib in U266 cell line: The values are mean of three replications results (Mean ± SEM) compared to the control group. The significance level is considered p < 0.05. GAPDH and U6 were used as the reference genes for XBP1 and microRNAs, respectively. Control columns represent levels of XBP1 and microRNAs in sensitive cells. Although all miRNAs have enhanced expression, merely miR-34c-5p showed a statistically significant increase

Full size image

As the level of miR-34c-5p was considerably different in the two sensitive and resistant groups, we blocked its expression in treated cells to see its effect on drug resistance and other gene expressions. Following its blockage, the level of the Bax and Bcl-2 was measured using qPCR. The expression of Bcl-2 was significantly reduced, resulting in more sensitive cells to the drug (Fig. 4). Besides, Bax level was elevated, which is in favor of apoptosis conditions. The cells showed a higher rate of apoptosis than the resistant cell line.

Fig. 4
figure 4

Results of real-time PCR after miR-34c-5p blockage by inhibitor. A After the blockage, there is an obvious reduction in miR-34c-5p expression level in the presence of bortezomib (compared to its expression in Fig. 3). B. The level of Bcl-2 showed a decrease after the miR inhibition. C. Bax mRNA also was increased as a result of blocking the miR

Full size image

To determine if miR-34c-5p inhibition re-sensitized resistant MM cells to bortezomib, we treated the bortezomib-resistant MM cells with 40 nM bortezomib for 24 h after transfection with either miR-34c-5p inhibitor or negative control inhibitor. Cell viability was then assessed using the MTT assay. Bortezomib treatment reduced cell viability by 32% in resistant MM cells transfected with negative control inhibitor. However, in resistant MM cells transfected with miR-34c-5p inhibitor, bortezomib treatment decreased cell viability by 62% (p < 0.05 compared to control inhibitor). These results demonstrate that inhibiting miR-34c-5p expression sensitized the resistant MM cells to bortezomib, inducing significantly higher cell death compared to resistant cells with normal miR-34c-5p expression.

Discussion

Drug-resistant is a major impediment in the treatment of MM patients, which is under investigation by many scientists to overcome cancerous cell survival. The success of bortezomib therapy is related to the high sensitivity of myeloma cells to proteasome activity, which plays an important role in the pathogenesis and progression of the disease [22]. However, the majority of patients ultimately experience bortezomib resistance and disease recurrence as a primary cause of myeloma incurability [17]. One of the objectives of our study was to find a new therapeutic target to diminish bortezomib resistance in the patients. In our study, inhibition of miR-34c-5p in resistant cells to bortezomib affected the expression of BAX and BCL-2 genes. Although it is not clear how this miR influences their level, it probably activates the apoptosis process and mediates cell death by regulating apoptotic factors, such as Bax/Bcl-2.

By exposing cells to an increasing dose of bortezomib, we created a resistant cell line, confirmed by a higher rate of IC50 parameter. XBP1 is a transcription factor of the UPR pathway. A kinase called IRE1, located in the endoplasmic reticulum membrane cleaves its mRNA during cellular stress. Using XBP1 as a mediator, IRE1 induces the expression of UPR pathway genes, including chaperones (Fig. 5). An investigation on susceptible and resistant cells to bortezomib showed that susceptible cells were associated with high levels of XBP1; While the level of XBP1 in resistant cells is low [23]. Concomitant with this paper, differential expression analysis of XBP1 revealed a lower expression in resistant cells. To explore the possible link between drug resistance of MM cells and microRNAs, we analyzed expressions of miR-214 and miR-30c-2* using qRT-PCR experiments.

Fig. 5
figure 5

Alterations in molecular pathways of resistant MM cells and after miR-34c-5p blockage. IRE1: Inositol-Requiring Enzyme 1, XBP1u: X-box binding protein 1 (inactive), XBP1s: active X-box binding protein 1, Bax: Bcl-2 Associated X-protein (a pro-apoptotic factor), Bcl-2: B-cell lymphoma 2

Full size image

Various studies proposed a connection between miR-214 and the suppression of cancer. For example, Patrice Cagle et al. reported that miR-214 significantly inhibited tyrosine kinase 6 (PTK6) protein, thereby reducing cell proliferation and survival. As a result, miR-214 can act as a tumor suppressor in prostate cancer [24]. Besides, expressed miR-30c-2* in ovarian cancer cells suppresses growth factor-induced proliferation and reduces BCL9 oncogenes transcription [25]. In 2018, Ostadrahimi et al. demonstrated the downregulation of hsa-miR-30c-2* expression in both tissue samples and cell lines of prostate cancer [26]. In contrast to previous studies [17, 18, 27], the level of hsa-miR-214 and hsa-miR-30c-2 were almost similar in resistant and sensitive cells, showing a slight increase in resistant cells. There is some explanation for this finding. Other microRNAs might affect the expression of the XBP1 gene and, by reducing XBP1, promote a resistant phenotype in multiple myeloma cells.

A recent relevant study by Yuan et al. performed such in-depth analyses, demonstrating that miR-520g and miR-520h overcome bortezomib resistance in MM by directly suppressing APE1 expression [28]. While our initial findings identify miR-34c-5p as a potential regulator of chemosensitivity, future studies should take a similar comprehensive approach to validate direct miR-34c-5p targets and test the efficacy of miR-34c-5p inhibition in improving bortezomib response in vivo. Adding these mechanistic experiments and discussion of related literature will lend stronger support to our conclusions regarding miR-34c-5p as a therapeutic target in drug-resistant MM.By measuring the expression amount of hsa-miR-34c-5p, Bax, and Bcl-2 in bortezomib-resistant cell lines before and after the miR inhibition, we reached the conclusion that it plays a role in the apoptosis pathway. Overexpression of Bax after the inhibition application is in favor of cancer cells’ susceptibility to drugs and apoptosis. To date, quite diverse roles have been reported for hsa-miR-34c-5p, namely tumor suppressor, neuroinflammatory, and apoptotic functions [29].

There are three subgroups of in Bcl-2 family based on their structure and function; Anti-apoptotic factors, such as Bcl-2, proapoptotic members like Bax and Bak, and BH3-only members [30]. Upregulation of anti-apoptotic proteins, such as Bcl-2, is a characteristic of cancerous cells and promotes cell survival and drug resistance [31]. Conversely, Bcl-2 reduction after hsa-miR-34c-5p blockage decrease survival, resulting in cancer cell death. Our findings demonstrated that hsa-miR-34c-5p regulates Bax/Bcl-2 expression to overcome bortezomib resistance in MM and suggested that hsa-miR-34c-5p can be a potential target for MM therapy.

Although we identified miR-34c-5p as a potential mediator of bortezomib response, it is likely multiple miRNAs work in concert to regulate chemoresistance through effects on shared apoptotic proteins. Comparing our results to related findings will help determine if miRNAs like miR-34c-5p act cooperatively with other identified miRNAs to control drug sensitivity [32].

Our results showed that miR-34c-5p inhibition re-sensitized resistant MM cells to bortezomib, inducing over 60% cell death compared to only 30% in resistant cells with normal miR-34c-5p expression. This provides functional evidence that targeting miR-34c-5p could overcome bortezomib resistance in MM.

While our study demonstrated that miR-34c-5p inhibition altered Bax and Bcl-2 mRNA levels in bortezomib-resistant MM cells, further studies are needed to confirm the effects on Bax and Bcl-2 protein expression. As the reviewer noted, the pro- and anti-apoptotic protein ratio determines cell fate, and mRNA expression may not always correlate directly with protein levels. To further validate our conclusions, future work should examine Bax and Bcl-2 protein expression following miR-34c-5p inhibition in bortezomib-resistant MM cells using western blotting or other protein analysis methods. Quantifying changes in Bax and Bcl-2 protein levels would provide stronger evidence that miR-34c-5p inhibition affects the expression of these apoptotic regulators at a functional level to promote apoptosis and overcome drug resistance in MM.

Additional experiments directly assessing the regulatory effects of ectopic hsa-miR-34c-5p expression on XBP1 levels would further establish their interconnection. Further investigations are needed to shed light on the exact role of hsa-miR-34c-5p in cell death and drug-resistant pathways and determine its link with apoptotic factors. In addition, the selected genes and microRNAs in this project can be studied in other myeloma cell lines to find out whether the level of hsa-miR-30c-2* and miR-214 significantly differ in other conditions. We can also explore the differential expression of other genes and microRNAs involved in MM drug resistance.

In future work, more comprehensive apoptosis analysis should be performed to validate the impact of miR-34c-5p inhibition on bortezomib-induced cell death. In this study, apoptosis was evaluated by measuring changes in mRNA levels of apoptosis-related genes Bax and Bcl-2 following miR-34c-5p knockdown. However, as the reviewer recommended, apoptosis should also be assessed using methods such as flow cytometry with Annexin V/PI staining. Quantifying the percentage of apoptotic cells by flow cytometry after bortezomib treatment with and without miR-34c-5p inhibition would provide stronger evidence of the effects on programmed cell death. Adding this standard technique to future studies will allow more robust confirmation of miR-34c-5p's role in regulating apoptosis and chemosensitivity.

In conclusion, our results demonstrate that miR-34c-5p is differentially expressed between bortezomib-sensitive and -resistant MM cell lines, and that inhibiting miR-34c-5p can re-sensitize resistant cells by modulating the expression of pro-apoptotic Bax and anti-apoptotic Bcl-2. Although further studies are needed to confirm the effects at the protein level, these findings indicate miR-34c-5p plays a role in regulating apoptosis and bortezomib resistance in MM. The ability of miR-34c-5p inhibition to restore bortezomib sensitivity suggests this miRNA could be a potential therapeutic target for overcoming drug resistance in MM patients. While future work is required to fully elucidate the mechanisms, our study provides initial evidence that miR-34c-5p contributes to bortezomib resistance and represents a promising new strategy to improve patient outcomes by enhancing the efficacy of proteasome inhibitor therapy.